pET29b-RupA_C1-A1-T1-CHis
(Plasmid
#109255)
-
PurposeNRPS module containing CAT domains with C-terminal 6His tag
-
Depositing Lab
-
Publication
-
Sequence Information
Ordering
Item | Catalog # | Description | Quantity | Price (USD) | |
---|---|---|---|---|---|
Plasmid | 109255 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $85 |
Backbone
-
Vector backbonepET29b
-
Backbone manufacturerNovagen
- Backbone size w/o insert (bp) 5370
- Total vector size (bp) 8370
-
Vector typeBacterial Expression
Growth in Bacteria
-
Bacterial Resistance(s)Kanamycin, 50 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)DH5alpha
-
Copy numberHigh Copy
Gene/Insert
-
Gene/Insert nameRupA_C1-A1-T1
-
SpeciesRuminococcus bromii
-
Insert Size (bp)3075
-
Mutationcontains aa 1..1025 of WP_015523502.1
-
GenBank IDNC_021013.1 WP_015523502.1
- Promoter T7
-
Tags
/ Fusion Proteins
- His tag (C terminal on backbone)
- S-Tag (N terminal on backbone)
Cloning Information
- Cloning method Restriction Enzyme
- 5′ cloning site BglII (not destroyed)
- 3′ cloning site XhoI (not destroyed)
- 5′ sequencing primer TAATACGACTCACTATAGGG
- 3′ sequencing primer GCTAGTTATTGCTCAGCGG (Common Sequencing Primers)
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
pET29b-RupA_C1-A1-T1-CHis was a gift from Emily Balskus (Addgene plasmid # 109255 ; http://n2t.net/addgene:109255 ; RRID:Addgene_109255) -
For your References section:
Discovery of small molecule protease inhibitors by investigating a widespread human gut bacterial biosynthetic pathway,. Schneider BA, EP Balskus. Tetrahedron 10.1016/j.tet.2018.03.043