pWL1 (mANGPTL8-V5-His)
(Plasmid
#109113)
-
PurposeExpresses V5 and His-tagged mouse ANGPTL8 in mammalian cells
-
Depositing Lab
-
Sequence Information
Ordering
Item | Catalog # | Description | Quantity | Price (USD) | |
---|---|---|---|---|---|
Plasmid | 109113 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $85 * |
* Log in to view industry pricing.
Backbone
-
Vector backbonepcDNA6
- Backbone size w/o insert (bp) 5058
- Total vector size (bp) 5652
-
Vector typeMammalian Expression
-
Selectable markersBlasticidin
Growth in Bacteria
-
Bacterial Resistance(s)Ampicillin, 100 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)DH5alpha
-
Copy numberHigh Copy
Gene/Insert
-
Gene/Insert nameANGPTL8
-
Alt nameLipasin
-
Alt nameRIFL
-
Alt namebetatrophin
-
SpeciesM. musculus (mouse)
-
Insert Size (bp)594
-
Entrez GeneAngptl8 (a.k.a. EG624219, Gm6484, Rifl)
- Promoter CMV
-
Tags
/ Fusion Proteins
- V5 (C terminal on backbone)
- 6x His (C terminal on backbone)
Cloning Information
- Cloning method Unknown
- 5′ sequencing primer TAATACGACTCACTATAGGG
- 3′ sequencing primer AGGAAAGGACAGTGGGAGTG (Common Sequencing Primers)
Resource Information
-
Supplemental Documents
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
Trademarks:
- Zeocin® is an InvivoGen trademark.
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
pWL1 (mANGPTL8-V5-His) was a gift from Brandon Davies (Addgene plasmid # 109113 ; http://n2t.net/addgene:109113 ; RRID:Addgene_109113) -
For your References section:
ANGPTL8 promotes the ability of ANGPTL3 to bind and inhibit lipoprotein lipase. Chi X, Britt EC, Shows HW, Hjelmaas AJ, Shetty SK, Cushing EM, Li W, Dou A, Zhang R, Davies BSJ. Mol Metab. 2017 Oct;6(10):1137-1149. doi: 10.1016/j.molmet.2017.06.014. Epub 2017 Jun 29. 10.1016/j.molmet.2017.06.014 PubMed 29031715