pET22b-ecDHFR
(Plasmid
#109055)
-
PurposeBacterial expression of E.coli DHFR protein
-
Depositing Lab
-
Sequence Information
Ordering
Item | Catalog # | Description | Quantity | Price (USD) | |
---|---|---|---|---|---|
Plasmid | 109055 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $85 |
Backbone
-
Vector backbonepET22b
-
Backbone manufacturerNovagen
- Backbone size w/o insert (bp) 5493
-
Vector typeBacterial Expression
Growth in Bacteria
-
Bacterial Resistance(s)Ampicillin, 100 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)DH5alpha
-
Copy numberLow Copy
Gene/Insert
-
Gene/Insert nameecDHFR
-
Alt namedihydrofolate reductase
-
Alt namefolA
-
SpeciesE.coli
-
Insert Size (bp)480
- Promoter T7
Cloning Information
- Cloning method Restriction Enzyme
- 5′ cloning site NdeI (not destroyed)
- 3′ cloning site BamHI (not destroyed)
- 5′ sequencing primer TAATACGACTCACTATAGGG (Common Sequencing Primers)
Resource Information
-
Article Citing this Plasmid
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
pET22b-ecDHFR was a gift from Stephen Benkovic (Addgene plasmid # 109055 ; http://n2t.net/addgene:109055 ; RRID:Addgene_109055) -
For your References section:
Evidence for a functional role of the dynamics of glycine-121 of Escherichia coli dihydrofolate reductase obtained from kinetic analysis of a site-directed mutant. Cameron CE, Benkovic SJ. Biochemistry. 1997 Dec 16;36(50):15792-800. doi: 10.1021/bi9716231. 10.1021/bi9716231 PubMed 9398309