pScDD2_ERdd
(Plasmid
#109047)
-
Purposedestabilizing domains for yeast (S. cerevisiae) derived from the human estrogen receptor ligand binding domain. This ERdd can be stabilized with 10 uM 4-hydroxytamoxifen (4-OHT, OHTAM).
-
Depositing Lab
-
Publication
-
Sequence Information
Ordering
Item | Catalog # | Description | Quantity | Price (USD) | |
---|---|---|---|---|---|
Plasmid | 109047 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $85 |
Backbone
-
Vector backbonepSc with SOD1 promoter
- Backbone size w/o insert (bp) 6292
- Total vector size (bp) 7765
-
Vector typeYeast Expression
-
Selectable markersKanMX4
Growth in Bacteria
-
Bacterial Resistance(s)Ampicillin, 100 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)DH5alpha
-
Copy numberHigh Copy
Gene/Insert
-
Gene/Insert nameER50
-
Alt nameERLBD
-
Alt nameERS1 ligand binding domain
-
SpeciesH. sapiens gene with yeast enhanced codon
-
Insert Size (bp)1473
-
Mutation3 mutations : E380G, R434G, N532S
-
GenBank IDBC128573.1
-
Entrez GeneESR1 (a.k.a. ER, ESR, ESRA, ESTRR, Era, NR3A1)
- Promoter SOD1
-
Tag
/ Fusion Protein
- yeast enhanced GFP with 8 amino acids TSGRGEGQ linker (N terminal on insert)
Cloning Information
- Cloning method Restriction Enzyme
- 5′ cloning site SmaI (not destroyed)
- 3′ cloning site SacII (not destroyed)
- 5′ sequencing primer GCTGTAACTATGTTGCGGAA ( in SOD promoter) or CCTTATCCAAAGATCCAAACG ( in yeGFP)
- 3′ sequencing primer TAGACAAGCCGACAACCTTG ( in ADH1 terminator) (Common Sequencing Primers)
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
pScDD2_ERdd was a gift from Thomas Wandless (Addgene plasmid # 109047 ; http://n2t.net/addgene:109047 ; RRID:Addgene_109047)