-
PurposeGroup II intron maturase from Eubacterium rectale (wild-type sequence). This is a highly processive reverse transcriptase that is called “MarathonRT”
-
Depositing Lab
-
Sequence Information
Ordering
Item | Catalog # | Description | Quantity | Price (USD) | |
---|---|---|---|---|---|
Plasmid | 109029 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $85 |
Backbone
-
Vector backboneChampionTM pET SUMO
-
Backbone manufacturerInvitrogen
- Backbone size w/o insert (bp) 5643
- Total vector size (bp) 6927
-
Vector typeBacterial Expression
Growth in Bacteria
-
Bacterial Resistance(s)Kanamycin, 50 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)DH5alpha
-
Copy numberUnknown
Gene/Insert
-
Gene/Insert nameERE_01490
-
SpeciesEubacterium rectale (Eu.re.I2)
-
Insert Size (bp)1284
-
GenBank IDCBK92290.1
- Promoter T7
-
Tag
/ Fusion Protein
- 6xHis-SUMO tag (N terminal on backbone)
Cloning Information
- Cloning method TOPO Cloning
- 5′ sequencing primer TTTGGACATGGAGGATAACG
- 3′ sequencing primer TAAGTTGGCAGCATCACCCG (Common Sequencing Primers)
Resource Information
-
Supplemental Documents
-
Article Citing this Plasmid
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
pET-6xHis-SUMO-MarathonRT was a gift from Anna Pyle (Addgene plasmid # 109029 ; http://n2t.net/addgene:109029 ; RRID:Addgene_109029) -
For your References section:
An ultraprocessive, accurate reverse transcriptase encoded by a metazoan group II intron. Zhao C, Liu F, Pyle AM. RNA. 2018 Feb;24(2):183-195. doi: 10.1261/rna.063479.117. Epub 2017 Nov 6. 10.1261/rna.063479.117 PubMed 29109157