pLenti-X1-Neo-GFP-ATL2-R244Q
(Plasmid #109023)

• Purpose: stable lentiviral expression of cDNA
• Depositing Lab: Jacob Corn
• Publication: Liang et al J Cell Biol. 2018 Aug 24. pii: jcb.201804185. doi: 10.1083/jcb.201804185.

Backbone

• Vector backbone: pLenti-X1-Neo
• Backbone manufacturer: Michael Rape
• Backbone size w/o insert (bp): 9005
• Vector type: Mammalian Expression, Lentiviral
• Selectable markers: Neomycin (select with G418) ; GFP

Growth in Bacteria

• Bacterial Resistance(s): Ampicillin, 100 μg/mL
• Growth Temperature: 30°C
• Growth Strain(s): NEB Stable
• Copy number: High Copy

Gene/Insert

• Gene/Insert name: ATL2-R244Q
• Species: H. sapiens (human)
• Insert Size (bp): 2493
• Mutation: Arg244Gln mutation results in dimerization defect
• Entrez Gene: ATL2 (a.k.a. ARL3IP2, ARL6IP2, aip-2, atlastin2)
• Promoter: EIF-1a promoter
• Tag / Fusion Protein:
  • eGFP (N terminal on insert)

Cloning Information

• Cloning method: Ligation Independent Cloning
• 5′ sequencing primer: AGCCTCAGACAGTGGTTCAA
• 3′ sequencing primer: agcagcgtatccacatagcgt

Terms and Licenses

• Academic/Nonprofit Terms:
  • UBMTA
• Industry Terms:
  • Not Available to Industry

Depositor Comments

This ATL2 construct has suspected genomic instability and/or leaky expression that results in bacteria toxicity if grown at 37'C. We recommend bacteria culture at 30'C for 24-36hrs and in large batch for significant yield.