Skip to main content
This website uses cookies to ensure you get the best experience. By continuing to use this site, you agree to the use of cookies.

Please note: Your browser does not support the features used on Addgene's website. You may not be able to create an account or request plasmids through this website until you upgrade your browser. Learn more

Please note: Your browser does not fully support some of the features used on Addgene's website. If you run into any problems registering, depositing, or ordering please contact us at [email protected]. Learn more

Addgene

pLenti-X1-Neo-GFP-ATL1-G20TM
(Plasmid #109019)

Ordering

This material is available to academics and nonprofits only.
Item Catalog # Description Quantity Price (USD)
Plasmid 109019 Standard format: Plasmid sent in bacteria as agar stab 1 $85

Backbone

  • Vector backbone
    pLenti-X1-Neo
  • Backbone manufacturer
    Michael Rape
  • Backbone size w/o insert (bp) 9005
  • Vector type
    Mammalian Expression, Lentiviral
  • Selectable markers
    Neomycin (select with G418) ; GFP

Growth in Bacteria

  • Bacterial Resistance(s)
    Ampicillin, 100 μg/mL
  • Growth Temperature
    37°C
  • Growth Strain(s)
    NEB Stable
  • Copy number
    High Copy

Gene/Insert

  • Gene/Insert name
    ATL1-deltaTM
  • Species
    H. sapiens (human)
  • Insert Size (bp)
    2091
  • Mutation
    truncated form without C-terminal ER transmembrane domain, delta450-558
  • Entrez Gene
    ATL1 (a.k.a. AD-FSP, FSP1, GBP3, HSN1D, SPG3, SPG3A, atlastin1)
  • Promoter EIF-1a promoter
  • Tag / Fusion Protein
    • eGFP (N terminal on insert)

Cloning Information

  • Cloning method Ligation Independent Cloning
  • 5′ sequencing primer AGCCTCAGACAGTGGTTCAA
  • 3′ sequencing primer agcagcgtatccacatagcgt
  • (Common Sequencing Primers)

Terms and Licenses

  • Academic/Nonprofit Terms
  • Industry Terms
    • Not Available to Industry
Trademarks:
  • Zeocin® is an InvivoGen trademark.
How to cite this plasmid ( Back to top)

These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.

  • For your Materials & Methods section:

    pLenti-X1-Neo-GFP-ATL1-G20TM was a gift from Jacob Corn (Addgene plasmid # 109019 ; http://n2t.net/addgene:109019 ; RRID:Addgene_109019)
  • For your References section:

    Atlastins remodel the endoplasmic reticulum for selective autophagy. Liang JR, Lingeman E, Ahmed S, Corn JE. J Cell Biol. 2018 Aug 24. pii: jcb.201804185. doi: 10.1083/jcb.201804185. 10.1083/jcb.201804185 PubMed 30143524