Skip to main content
Addgene

pLG1-puro-sgATL2-2
(Plasmid #109009)

Print

Ordering

This material is available to academics and nonprofits only.
Item Catalog # Description Quantity Price (USD)
Plasmid 109009 Standard format: Plasmid sent in bacteria as agar stab 1 $85
Add to Cart

Backbone

  • Vector backbone
    pCRISPRia-v2
  • Backbone manufacturer
    Jonathan Weissman, Addgene #84839
  • Backbone size w/o insert (bp) 8200
  • Vector type
    Mammalian Expression, Lentiviral
  • Selectable markers
    Puromycin ; BFP

Growth in Bacteria

  • Bacterial Resistance(s)
    Ampicillin, 100 μg/mL
  • Growth Temperature
    37°C
  • Growth Strain(s)
    NEB Stable
  • Copy number
    High Copy

Gene/Insert

  • Gene/Insert name
    ATL2-sgRNA #2
  • gRNA/shRNA sequence
    GTAGCTGCTGGGAGAACCAG
  • Species
    H. sapiens (human)
  • Entrez Gene
    ATL2 (a.k.a. ARL3IP2, ARL6IP2, aip-2, atlastin2)
  • Promoter mU6 promoter

Cloning Information

  • Cloning method Restriction Enzyme
  • 5′ cloning site BstX1 (not destroyed)
  • 3′ cloning site BlpI (not destroyed)
  • 5′ sequencing primer gcgccaattctgcagacaaa
  • 3′ sequencing primer CCTTCTCTAGGCACCGGTTC
    • (Common Sequencing Primers)

Terms and Licenses

Trademarks:
  • Zeocin® is an InvivoGen trademark.
How to cite this plasmid ( Back to top)

These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.

  • For your Materials & Methods section:

    pLG1-puro-sgATL2-2 was a gift from Jacob Corn (Addgene plasmid # 109009 ; http://n2t.net/addgene:109009 ; RRID:Addgene_109009)

  • For your References section:

    Atlastins remodel the endoplasmic reticulum for selective autophagy. Liang JR, Lingeman E, Ahmed S, Corn JE. J Cell Biol. 2018 Aug 24. pii: jcb.201804185. doi: 10.1083/jcb.201804185. 10.1083/jcb.201804185 PubMed 30143524
Related items:
Commonly requested with: