-
PurposeSelflabeling tag at ATP Synthase
-
Depositing Lab
-
Sequence Information
Ordering
Item | Catalog # | Description | Quantity | Price (USD) | |
---|---|---|---|---|---|
Plasmid | 108933 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $85 |
Backbone
-
Vector backbonepSEMS(26m)
-
Backbone manufacturerCovalys, NEB
- Backbone size w/o insert (bp) 5325
- Total vector size (bp) 7026
-
Modifications to backboneoriginal snap-Tag substituted by Halo7-Tag
-
Vector typeMammalian Expression
-
Selectable markersNeomycin (select with G418)
Growth in Bacteria
-
Bacterial Resistance(s)Ampicillin, 100 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)DH5alpha
-
Copy numberHigh Copy
Gene/Insert
-
Gene/Insert nameATP synthase F1 subunit gamma
-
Alt nameATP5F1C
-
SpeciesH. sapiens (human)
-
Insert Size (bp)891
-
GenBank IDNM_001001973.2
-
Entrez GeneATP5F1C (a.k.a. ATP5C, ATP5C1, ATP5CL1)
- Promoter CMV
-
Tag
/ Fusion Protein
- Halo7 tag (C terminal on insert)
Cloning Information
- Cloning method Restriction Enzyme
- 5′ cloning site ClaI (not destroyed)
- 3′ cloning site EcoRI (not destroyed)
- 5′ sequencing primer ATCGATATGTTCTCTCGCGCGGGTGTCGCTGGGCTGTCGGCC
- 3′ sequencing primer GAAATTATCTCTGGTGCTGCAGCTCTGGCGGAATTCCG (Common Sequencing Primers)
Resource Information
-
Supplemental Documents
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
pSEMS-CV SUy-Halo7Tag was a gift from Karin Busch (Addgene plasmid # 108933 ; http://n2t.net/addgene:108933 ; RRID:Addgene_108933) -
For your References section:
Restricted diffusion of OXPHOS complexes in dynamic mitochondria delays their exchange between cristae and engenders a transitory mosaic distribution. Wilkens V, Kohl W, Busch K. J Cell Sci. 2013 Jan 1;126(Pt 1):103-16. doi: 10.1242/jcs.108852. Epub 2012 Oct 4. 10.1242/jcs.108852 PubMed 23038773