Skip to main content
This website uses cookies to ensure you get the best experience. By continuing to use this site, you agree to the use of cookies.

Please note: Your browser does not support the features used on Addgene's website. You may not be able to create an account or request plasmids through this website until you upgrade your browser. Learn more

Please note: Your browser does not fully support some of the features used on Addgene's website. If you run into any problems registering, depositing, or ordering please contact us at [email protected]. Learn more

Addgene

pCS2 Halo-Tev- HSPB7 (zebrafish) WT
(Plasmid #108916)

Ordering

This material is available to academics and nonprofits only.
Item Catalog # Description Quantity Price (USD)
Plasmid 108916 Standard format: Plasmid sent in bacteria as agar stab 1 $85

Backbone

  • Vector backbone
    pCS2
  • Backbone size w/o insert (bp) 4697
  • Total vector size (bp) 6065
  • Vector type
    Mammalian Expression

Growth in Bacteria

  • Bacterial Resistance(s)
    Ampicillin, 100 μg/mL
  • Growth Temperature
    37°C
  • Growth Strain(s)
    DH5alpha
  • Copy number
    High Copy

Gene/Insert

  • Gene/Insert name
    Halo-TEV-HSPB7
  • Alt name
    Heat shock protein family B (small) member 7
  • Species
    D. rerio (zebrafish)
  • Insert Size (bp)
    1401
  • Entrez Gene
    hspb7 (a.k.a. zgc:103426)
  • Promoter SP6
  • Tag / Fusion Protein
    • Halo-TEV (N terminal on insert)

Cloning Information

  • Cloning method Unknown
  • 5′ sequencing primer ATTTAGGTGACACTATAG
  • 3′ sequencing primer gtggtttgtccaaactcatc
  • (Common Sequencing Primers)

Terms and Licenses

Trademarks:
  • Zeocin® is an InvivoGen trademark.
How to cite this plasmid ( Back to top)

These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.

  • For your Materials & Methods section:

    pCS2 Halo-Tev- HSPB7 (zebrafish) WT was a gift from Yimon Aye (Addgene plasmid # 108916 ; http://n2t.net/addgene:108916 ; RRID:Addgene_108916)
  • For your References section:

    Cardiovascular Small Heat Shock Protein HSPB7 Is a Kinetically Privileged Reactive Electrophilic Species (RES) Sensor. Surya SL, Long MJC, Urul DA, Zhao Y, Mercer EJ, EIsaid IM, Evans T, Aye Y. ACS Chem Biol. 2018 Feb 8. doi: 10.1021/acschembio.7b00925. 10.1021/acschembio.7b00925 PubMed 29397684