Skip to main content
Addgene

pCS2 Halo-Tev- HSPB7 (zebrafish) C49S and C117S
(Plasmid #108913)

Ordering

This material is available to academics and nonprofits only.
Item Catalog # Description Quantity Price (USD)
Plasmid 108913 Standard format: Plasmid sent in bacteria as agar stab 1 $85

Backbone

  • Vector backbone
    pCS2
  • Backbone size w/o insert (bp) 4697
  • Total vector size (bp) 6065
  • Vector type
    Mammalian Expression

Growth in Bacteria

  • Bacterial Resistance(s)
    Ampicillin, 100 μg/mL
  • Growth Temperature
    37°C
  • Growth Strain(s)
    DH5alpha
  • Copy number
    High Copy

Gene/Insert

  • Gene/Insert name
    Halo-TEV-HSPB7
  • Alt name
    Heat shock protein family B (small) member 7
  • Species
    D. rerio (zebrafish)
  • Insert Size (bp)
    1401
  • Mutation
    Cysteine 49 to Serine, Cysteine 117 to Serine
  • Promoter SP6
  • Tag / Fusion Protein
    • Halo-TEV (N terminal on insert)

Cloning Information

  • Cloning method Unknown
  • 5′ sequencing primer ATTTAGGTGACACTATAG
  • 3′ sequencing primer gtggtttgtccaaactcatc
  • (Common Sequencing Primers)

Terms and Licenses

Trademarks:
  • Zeocin® is an InvivoGen trademark.
How to cite this plasmid ( Back to top)

These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.

  • For your Materials & Methods section:

    pCS2 Halo-Tev- HSPB7 (zebrafish) C49S and C117S was a gift from Yimon Aye (Addgene plasmid # 108913 ; http://n2t.net/addgene:108913 ; RRID:Addgene_108913)
  • For your References section:

    Cardiovascular Small Heat Shock Protein HSPB7 Is a Kinetically Privileged Reactive Electrophilic Species (RES) Sensor. Surya SL, Long MJC, Urul DA, Zhao Y, Mercer EJ, EIsaid IM, Evans T, Aye Y. ACS Chem Biol. 2018 Feb 8. doi: 10.1021/acschembio.7b00925. 10.1021/acschembio.7b00925 PubMed 29397684