-
PurposeExpression of heat shock inducible Cas9-GFP and U6-driven 5 individual gRNAs for scGESTALT in zebrafish
-
Depositing Lab
-
Sequence Information
Ordering
Item | Catalog # | Description | Quantity | Price (USD) | |
---|---|---|---|---|---|
Plasmid | 108871 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $89 |
Backbone
-
Vector backboneTol2
- Backbone size w/o insert (bp) 5853
- Total vector size (bp) 13822
-
Vector typeCRISPR
Growth in Bacteria
-
Bacterial Resistance(s)Ampicillin, 100 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)DH5alpha
-
Growth instructionsDue to size of vector, bacteria are slow growing. Grow larger cultures for high plasmid recovery.
-
Copy numberUnknown
Gene/Insert 1
-
Gene/Insert name5xU6:sgRNA
-
SpeciesD. rerio (zebrafish), Synthetic
-
Insert Size (bp)2693
- Promoter U6
Cloning Information for Gene/Insert 1
- Cloning method Restriction Enzyme
- 5′ cloning site ClaI (not destroyed)
- 3′ cloning site KpnI (not destroyed)
- 5′ sequencing primer ACATTAAATGAAATGCATcagt (Common Sequencing Primers)
Gene/Insert 2
-
Gene/Insert nameCas9-t2A-GFP
-
SpeciesD. rerio (zebrafish)
-
Insert Size (bp)5276
- Promoter hsp70
Cloning Information for Gene/Insert 2
- Cloning method Gateway Cloning
- 5′ sequencing primer TTACTTGTACAGCTCGTCCATGCC (Common Sequencing Primers)
Resource Information
-
Supplemental Documents
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
pTol2-hsp70l:Cas9-t2A-GFP, 5xU6:sgRNA was a gift from Alex Schier (Addgene plasmid # 108871 ; http://n2t.net/addgene:108871 ; RRID:Addgene_108871) -
For your References section:
Simultaneous single-cell profiling of lineages and cell types in the vertebrate brain. Raj B, Wagner DE, McKenna A, Pandey S, Klein AM, Shendure J, Gagnon JA, Schier AF. Nat Biotechnol. 2018 Mar 28. pii: nbt.4103. doi: 10.1038/nbt.4103. 10.1038/nbt.4103 PubMed 29608178