EcPPK1
(Plasmid
#108850)
-
PurposeExpresses E. coli PPK1 in mammalian cell lines
-
Depositing Lab
-
Sequence Information
Ordering
Item | Catalog # | Description | Quantity | Price (USD) | |
---|---|---|---|---|---|
Plasmid | 108850 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $85 |
Backbone
-
Vector backbonepcDNA3.1(-)
- Backbone size w/o insert (bp) 5428
- Total vector size (bp) 7472
-
Vector typeMammalian Expression
-
Selectable markersZeocin
Growth in Bacteria
-
Bacterial Resistance(s)Ampicillin, 100 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)DH5alpha
-
Copy numberHigh Copy
Gene/Insert
-
Gene/Insert namePolyphosphate Kinase 1
-
Alt namePPK1
-
SpeciesE. coli
-
Insert Size (bp)2067
- Promoter CMV
Cloning Information
- Cloning method Gibson Cloning
- 5′ sequencing primer TCCACCACACTGGACTAGTGATGGGTCAGGAAAAGCTATAC
- 3′ sequencing primer TGATCAGCGGTTTAAACTTATTATTCAGGTTGTTCGAGTG (Common Sequencing Primers)
Resource Information
-
A portion of this plasmid was derived from a plasmid made byPPK origin is Université de Lausanne
-
Article Citing this Plasmid
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
EcPPK1 was a gift from Michael Downey (Addgene plasmid # 108850 ; http://n2t.net/addgene:108850 ; RRID:Addgene_108850) -
For your References section:
A Screen for Candidate Targets of Lysine Polyphosphorylation Uncovers a Conserved Network Implicated in Ribosome Biogenesis. Bentley-DeSousa A, Holinier C, Moteshareie H, Tseng YC, Kajjo S, Nwosu C, Amodeo GF, Bondy-Chorney E, Sai Y, Rudner A, Golshani A, Davey NE, Downey M. Cell Rep. 2018 Mar 27;22(13):3427-3439. doi: 10.1016/j.celrep.2018.02.104. 10.1016/j.celrep.2018.02.104 PubMed 29590613