pEGFP‐RNASEH2B
(Plasmid #108697)

• Purpose: For expression of N-terminally eGFP-tagged human RNASEH2B in mammalian cells
• Depositing Labs: Andrew Jackson, Martin Reijns
• Publication: Bubeck et al Nucleic Acids Res. 2011 May;39(9):3652-66. doi: 10.1093/nar/gkq980. Epub 2011 Jan 17.

Backbone

• Vector backbone: pEGFP-Dest (LMBP 4542)
• Backbone manufacturer: LMBP
• Backbone size w/o insert (bp): 4804
• Total vector size (bp): 5743
• Vector type: Mammalian Expression
• Selectable markers: Neomycin (select with G418)

Growth in Bacteria

• Bacterial Resistance(s): Kanamycin, 50 μg/mL
• Growth Temperature: 37°C
• Growth Strain(s): DH5alpha
• Copy number: High Copy

Gene/Insert

• Gene/Insert name: RNASEH2B
• Species: H. sapiens (human)
• Entrez Gene: RNASEH2B (a.k.a. AGS2, DLEU8)
• Promoter: CMV
• Tag / Fusion Protein:
  • GFP (N terminal on backbone)

Cloning Information

• Cloning method: Gateway Cloning
• 5′ sequencing primer: cgatcacatggtcctgctg
• 3′ sequencing primer: tctacaaatgtggtatggctg

Resource Information

• Supplemental Documents:
  • pEGFP-RNASEH2B.gb
• Articles Citing this Plasmid:
  • 3 References

Terms and Licenses

• Academic/Nonprofit Terms:
  • UBMTA
• Industry Terms:
  • Not Available to Industry