pGEX6P1‐Afu rnhB
(Plasmid #108694)

• Purpose: For expression in E coli, and affinity purification of N-terminally GST-tagged Archaeoglobus fulgidus RNase HII
• Depositing Labs: Andrew Jackson, Martin Reijns
• Publication: Reijns et al J Biol Chem. 2011 Mar 25;286(12):10530-9. doi: 10.1074/jbc.M110.177394. Epub 2010 Dec 22.

Backbone

• Vector backbone: pGEX6P1
• Backbone manufacturer: Amersham
• Backbone size w/o insert (bp): 4984
• Total vector size (bp): 5606
• Modifications to backbone: SacI site added between between rnhB stop codon and NotI site
• Vector type: Bacterial Expression

Growth in Bacteria

• Bacterial Resistance(s): Ampicillin, 100 μg/mL
• Growth Temperature: 37°C
• Growth Strain(s): DH5alpha
• Copy number: High Copy

Gene/Insert

• Gene/Insert name: rnhB
• Alt name: RNase HII
• Species: Archaeoglobus fulgidus
• Entrez Gene: AF_RS03165 (a.k.a. AF_RS03165, AF0621)
• Promoter: tac
• Tag / Fusion Protein:
  • GST (N terminal on insert)

Cloning Information

• Cloning method: Restriction Enzyme
• 5′ cloning site: SalI (not destroyed)
• 3′ cloning site: NotI (not destroyed)
• 5′ sequencing primer: GGGCTGGCAAGCCACGTTTGGTG
• 3′ sequencing primer: CCGGGAGCTGCATGTGTCAGAGG

Resource Information

• Supplemental Documents:
  • pGEX6P1-Afu-rnhB.gb

Terms and Licenses

• Academic/Nonprofit Terms:
  • UBMTA
• Industry Terms:
  • Not Available to Industry