Skip to main content
This website uses cookies to ensure you get the best experience. By continuing to use this site, you agree to the use of cookies.

Please note: Your browser does not support the features used on Addgene's website. You may not be able to create an account or request plasmids through this website until you upgrade your browser. Learn more

Please note: Your browser does not fully support some of the features used on Addgene's website. If you run into any problems registering, depositing, or ordering please contact us at [email protected]. Learn more

Addgene

pGEX6P1‐hsRNASEH2BCA(D34A/D169A)
(Plasmid #108693)

Ordering

This material is available to academics and nonprofits only.
Item Catalog # Description Quantity Price (USD)
Plasmid 108693 Standard format: Plasmid sent in bacteria as agar stab 1 $85

Backbone

  • Vector backbone
    pGEX6P1
  • Backbone manufacturer
    Amersham
  • Backbone size w/o insert (bp) 4984
  • Total vector size (bp) 7400
  • Modifications to backbone
    SacI site added between between RNASEH2A stop codon and NotI site
  • Vector type
    Bacterial Expression

Growth in Bacteria

  • Bacterial Resistance(s)
    Ampicillin, 100 μg/mL
  • Growth Temperature
    37°C
  • Growth Strain(s)
    DH5alpha
  • Copy number
    High Copy

Gene/Insert 1

  • Gene/Insert name
    RNASEH2B
  • Species
    H. sapiens (human)
  • Insert Size (bp)
    938
  • Mutation
    excluding methionine start
  • Promoter tac
  • Tag / Fusion Protein
    • GST (N terminal on insert)

Cloning Information for Gene/Insert 1

  • Cloning method Restriction Enzyme
  • 5′ cloning site SalI (not destroyed)
  • 3′ cloning site ClaI (not destroyed)
  • 5′ sequencing primer GGGCTGGCAAGCCACGTTTGGTG
  • 3′ sequencing primer CGTCGCCGCTCTCCATATG
  • (Common Sequencing Primers)

Gene/Insert 2

  • Gene/Insert name
    RNASEH2C
  • Species
    H. sapiens (human)
  • Mutation
    Shine Dalgarno sequence upstream of start codon
  • Entrez Gene
    RNASEH2C (a.k.a. AGS3, AYP1)

Cloning Information for Gene/Insert 2

  • Cloning method Restriction Enzyme
  • 5′ cloning site ClaI (not destroyed)
  • 3′ cloning site KpnI (not destroyed)
  • 5′ sequencing primer AATTGGAAAGGTTTGAAACGAC
  • 3′ sequencing primer CTGTATTGTCTCTCTCCAGC
  • (Common Sequencing Primers)

Gene/Insert 3

  • Gene/Insert name
    RNASEH2A-D34A/D169A
  • Species
    H. sapiens (human)
  • Insert Size (bp)
    900
  • Mutation
    Shine Dalgarno sequence upstream of start codon; D34A and D169A catalytic site mutations

Cloning Information for Gene/Insert 3

  • Cloning method Restriction Enzyme
  • 5′ cloning site KpnI (not destroyed)
  • 3′ cloning site SacI/NotI (not destroyed)
  • 5′ sequencing primer ATTCACGCACAGGTGCCCG
  • 3′ sequencing primer CCGGGAGCTGCATGTGTCAGAGG
  • (Common Sequencing Primers)

Resource Information

Terms and Licenses

  • Academic/Nonprofit Terms
  • Industry Terms
    • Not Available to Industry
Trademarks:
  • Zeocin® is an InvivoGen trademark.
How to cite this plasmid ( Back to top)

These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.

  • For your Materials & Methods section:

    pGEX6P1‐hsRNASEH2BCA(D34A/D169A) was a gift from Andrew Jackson & Martin Reijns (Addgene plasmid # 108693 ; http://n2t.net/addgene:108693 ; RRID:Addgene_108693)
  • For your References section:

    The structure of the human RNase H2 complex defines key interaction interfaces relevant to enzyme function and human disease. Reijns MA, Bubeck D, Gibson LC, Graham SC, Baillie GS, Jones EY, Jackson AP. J Biol Chem. 2011 Mar 25;286(12):10530-9. doi: 10.1074/jbc.M110.177394. Epub 2010 Dec 22. 10.1074/jbc.M110.177394 PubMed 21177854