-
PurposeFor expression in E coli of N-terminally GST-tagged human RNASEH2B and untagged RNASEH2C and A, allowing affinity purification of the RNase H2 trimeric enzyme
-
Depositing Labs
-
Sequence Information
Ordering
Item | Catalog # | Description | Quantity | Price (USD) | |
---|---|---|---|---|---|
Plasmid | 108692 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $85 |
Backbone
-
Vector backbonepGEX6P1
-
Backbone manufacturerAmersham
- Backbone size w/o insert (bp) 4984
- Total vector size (bp) 7400
-
Modifications to backboneSacI site added between between RNASEH2A stop codon and NotI site
-
Vector typeBacterial Expression
Growth in Bacteria
-
Bacterial Resistance(s)Ampicillin, 100 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)DH5alpha
-
Copy numberHigh Copy
Gene/Insert 1
-
Gene/Insert nameRNASEH2B
-
SpeciesH. sapiens (human)
-
Insert Size (bp)938
-
Mutationexcluding methionine start
-
Entrez GeneRNASEH2B (a.k.a. AGS2, DLEU8)
- Promoter tac
-
Tag
/ Fusion Protein
- GST (N terminal on insert)
Cloning Information for Gene/Insert 1
- Cloning method Restriction Enzyme
- 5′ cloning site SalI (not destroyed)
- 3′ cloning site ClaI (not destroyed)
- 5′ sequencing primer GGGCTGGCAAGCCACGTTTGGTG
- 3′ sequencing primer CGTCGCCGCTCTCCATATG (Common Sequencing Primers)
Gene/Insert 2
-
Gene/Insert nameRNASEH2C
-
SpeciesH. sapiens (human)
-
MutationShine Dalgarno sequence upstream of start codon
-
Entrez GeneRNASEH2C (a.k.a. AGS3, AYP1)
Cloning Information for Gene/Insert 2
- Cloning method Restriction Enzyme
- 5′ cloning site ClaI (not destroyed)
- 3′ cloning site KpnI (not destroyed)
- 5′ sequencing primer AATTGGAAAGGTTTGAAACGAC
- 3′ sequencing primer CTGTATTGTCTCTCTCCAGC (Common Sequencing Primers)
Gene/Insert 3
-
Gene/Insert nameRNASEH2A
-
SpeciesH. sapiens (human)
-
Insert Size (bp)900
-
MutationShine Dalgarno sequence upstream of start codon
-
Entrez GeneRNASEH2A (a.k.a. AGS4, JUNB, RNASEHI, RNHIA, RNHL, THSD8)
Cloning Information for Gene/Insert 3
- Cloning method Restriction Enzyme
- 5′ cloning site KpnI (not destroyed)
- 3′ cloning site SacI/NotI (not destroyed)
- 5′ sequencing primer ATTCACGCACAGGTGCCCG
- 3′ sequencing primer CCGGGAGCTGCATGTGTCAGAGG (Common Sequencing Primers)
Resource Information
-
Supplemental Documents
-
Articles Citing this Plasmid
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
pGEX6P1‐hsRNASEH2BCA was a gift from Andrew Jackson & Martin Reijns (Addgene plasmid # 108692 ; http://n2t.net/addgene:108692 ; RRID:Addgene_108692) -
For your References section:
The structure of the human RNase H2 complex defines key interaction interfaces relevant to enzyme function and human disease. Reijns MA, Bubeck D, Gibson LC, Graham SC, Baillie GS, Jones EY, Jackson AP. J Biol Chem. 2011 Mar 25;286(12):10530-9. doi: 10.1074/jbc.M110.177394. Epub 2010 Dec 22. 10.1074/jbc.M110.177394 PubMed 21177854