-
PurposeStrong CAG promoter with mCherry expression for transfection efficacy screening
-
Depositing Lab
-
Sequence Information
Ordering
Item | Catalog # | Description | Quantity | Price (USD) | |
---|---|---|---|---|---|
Plasmid | 108685 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $89 |
Backbone
-
Vector backboneColE1
- Backbone size w/o insert (bp) 4888
- Total vector size (bp) 5599
-
Vector typeMammalian Expression
Growth in Bacteria
-
Bacterial Resistance(s)Ampicillin, 100 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)DH5alpha
-
Copy numberLow Copy
Gene/Insert
-
Gene/Insert namemCherry
-
Insert Size (bp)795
- Promoter CAG
Cloning Information
- Cloning method TOPO Cloning
- 5′ sequencing primer TACAGCTCCTGGGCAACGTG
- 3′ sequencing primer CCC ATA TGT CCT TCC GAG TG (Common Sequencing Primers)
Resource Information
-
A portion of this plasmid was derived from a plasmid made byKarl Wahlin
-
Articles Citing this Plasmid
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
Depositor Comments
Please visit https://www.biorxiv.org/content/early/2018/02/13/264390 for bioRxiv preprint.
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
CAG-mCherry was a gift from Jordan Green (Addgene plasmid # 108685 ; http://n2t.net/addgene:108685 ; RRID:Addgene_108685) -
For your References section:
A combinatorial library of biodegradable polyesters enables non-viral gene delivery to post-mitotic human stem cell-derived polarized RPE monolayers. Mishra B, Wilson DR, Sripathi SR, Suprenant MP, Rui Y, Wahlin KJ, Berlinicke CA, Green JJ, Zack DJ. Regen Eng Transl Med. 2019 Sep;6(3):273-285. doi: 10.1007/s40883-019-00118-1. Epub 2019 Jul 24. 10.1007/s40883-019-00118-1 PubMed 33732871