-
PurposeTunable system for controlled gene expression and protein stability in mammalian cells
-
Depositing Lab
-
Sequence Information
Ordering
Item | Catalog # | Description | Quantity | Price (USD) | |
---|---|---|---|---|---|
Plasmid | 108679 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $85 |
Backbone
-
Vector backbonepLVX
- Backbone size w/o insert (bp) 7849
- Total vector size (bp) 9044
-
Vector typeMammalian Expression, Lentiviral
-
Selectable markersPuromycin
Growth in Bacteria
-
Bacterial Resistance(s)Ampicillin, 100 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)NEB Stable
-
Copy numberHigh Copy
Gene/Insert
-
Gene/Insert nameDestabilizing Domain (DD) mCherry fusion protein
-
Alt nameDD::mCherry
-
Insert Size (bp)1267
- Promoter Doxycycline inducible
-
Tag
/ Fusion Protein
- DD::mCherry fusion protein (N terminal on insert)
Cloning Information
- Cloning method Gibson Cloning
- 5′ sequencing primer CGCGGCCGCGGATCCCCCGGGCCACATGATCAGCCTGATCGCCGC
- 3′ sequencing primer GCTTCTCGAGGAATTCCCCGGGTTACTTGTACAGCTCGTCCATGC (Common Sequencing Primers)
Resource Information
-
Supplemental Documents
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
Depositor Comments
These Materials were created under an MRC grant. Any publications which include use of these materials must acknowledge the MRC as follows: "This work was supported by the Medical Research Council grant number MR/N021444/1."
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
pLVX_TRE3G_DD::mCherry was a gift from Lucia Marucci (Addgene plasmid # 108679 ; http://n2t.net/addgene:108679 ; RRID:Addgene_108679) -
For your References section:
A tunable dual-input system for on-demand dynamic gene expression regulation. Pedone E, Postiglione L, Aulicino F, Rocca DL, Montes-Olivas S, Khazim M, di Bernardo D, Pia Cosma M, Marucci L. Nat Commun. 2019 Oct 2;10(1):4481. doi: 10.1038/s41467-019-12329-9. 10.1038/s41467-019-12329-9 PubMed 31578371