pEJS887_pTetR-P2A-BFPnls/sgAlpha
(Plasmid #108651)

• Purpose: Alpha satellite repeats targeting Spy sgRNA under U6 promoter
• Depositing Lab: Erik Sontheimer
• Publication: Gao et al Nat Methods. 2018 Jun;15(6):433-436. doi: 10.1038/s41592-018-0006-2. Epub 2018 May 7.

Backbone

• Vector backbone: pLKO.1
• Backbone size w/o insert (bp): 8000
• Total vector size (bp): 8610
• Vector type: Mammalian Expression, Lentiviral, CRISPR

Growth in Bacteria

• Bacterial Resistance(s): Ampicillin, 100 μg/mL
• Growth Temperature: 37°C
• Growth Strain(s): NEB Stable
• Copy number: High Copy

Gene/Insert 1

• Gene/Insert name: Alpha satellite repeats targeting sgRNA
• Species: Synthetic
• Insert Size (bp): 112
• Promoter: U6
• Tag / Fusion Protein:
  • No

Cloning Information for Gene/Insert 1

• Cloning method: Gibson Cloning
• 5′ sequencing primer: gcatatacgatacaaggctgt

Gene/Insert 2

• Gene/Insert name: TetR-P2A-BFP
• Species: Synthetic
• Insert Size (bp): 1437
• Promoter: hPGK

Cloning Information for Gene/Insert 2

• Cloning method: Gibson Cloning
• 5′ sequencing primer: cattctgcaagcctccgg

Resource Information

• Supplemental Documents:
  • pEJS887(pTetR_P2A_BFPnls sgAlpha).gbk
• A portion of this plasmid was derived from a plasmid made by: pTetR-P2A-BFPnls-sgRNA1-2XBroccoli-C3-6mer was a gift from David Grunwald Lab (published in Ma et al J. Cell Biol. 2016).

Terms and Licenses

• Academic/Nonprofit Terms:
  • UBMTA
  • Evrogen Limited Use Label License for FPs
• Industry Terms:
  • Not Available to Industry

Depositor Comments

CRISPR-Cas9 nuclear dynamics and target recognition in living cells. Ma, H., Tu, L.-C., Naseri, A., Huisman, M., Zhang, S., Grunwald, D., and Pederson, T. (2016). CRISPR-Cas9 nuclear dynamics and target recognition in living cells. The Journal of Cell Biology 214, 529–537.