pEJS614_pTetR-P2A-BFPnls/sgNS
(Plasmid #108650)

• Purpose: Non-specific Spy sgRNA under U6 promoter
• Depositing Lab: Erik Sontheimer
• Publication: Gao et al Nat Methods. 2018 Jun;15(6):433-436. doi: 10.1038/s41592-018-0006-2. Epub 2018 May 7.

Backbone

• Vector backbone: pLKO.1
• Backbone size w/o insert (bp): 8000
• Total vector size (bp): 8612
• Vector type: Mammalian Expression, Lentiviral, CRISPR

Growth in Bacteria

• Bacterial Resistance(s): Ampicillin, 100 μg/mL
• Growth Temperature: 37°C
• Growth Strain(s): NEB Stable
• Copy number: High Copy

Gene/Insert 1

• Gene/Insert name: Non-specific sgRNA
• Species: Synthetic
• Insert Size (bp): 114
• Promoter: U6
• Tag / Fusion Protein:
  • No

Cloning Information for Gene/Insert 1

• Cloning method: Gibson Cloning
• 5′ sequencing primer: gcatatacgatacaaggctgt

Gene/Insert 2

• Gene/Insert name: TetR-P2A-BFP
• Species: Synthetic
• Insert Size (bp): 1437
• Promoter: hPGK

Cloning Information for Gene/Insert 2

• Cloning method: Gibson Cloning
• 5′ sequencing primer: cattctgcaagcctccgg

Resource Information

• Supplemental Documents:
  • pEJS614(pTetR_P2A_BFPnls sgNS).gbk
• A portion of this plasmid was derived from a plasmid made by: pTetR-P2A-BFPnls-sgRNA1-2XBroccoli-C3-6mer was a gift from David Grunwald Lab (published in Ma et al J. Cell Biol. 2016).
• Article Citing this Plasmid:
  • 1 Reference

Terms and Licenses

• Academic/Nonprofit Terms:
  • UBMTA
  • Evrogen Limited Use Label License for FPs
• Industry Terms:
  • Not Available to Industry

Depositor Comments

1. Knight, S.C., Xie, L., Deng, W., Guglielmi, B., Witkowsky, L.B., Bosanac, L., Zhang, E.T., El Beheiry, M., Masson, J.-B.B., Dahan, M., et al. (2015). Dynamics of CRISPR-Cas9 genome interrogation in living cells. Science 350, 823–826.
2. CRISPR-Cas9 nuclear dynamics and target recognition in living cells. Ma, H., Tu, L.-C., Naseri, A., Huisman, M., Zhang, S., Grunwald, D., and Pederson, T. (2016). CRISPR-Cas9 nuclear dynamics and target recognition in living cells. The Journal of Cell Biology 214, 529–537.