GST PTBP1 isoform 4
(Plasmid #108594)

• Purpose: Recombinant GST tagged protein production
• Depositing Lab: Chris Smith
• Publication: Coelho et al EMBO J. 2015 Mar 4;34(5):653-68. doi: 10.15252/embj.201489852. Epub 2015 Jan 19.

Backbone

• Vector backbone: pGEX4T1
• Backbone manufacturer: GE Healthcare Life Sciences
• Backbone size w/o insert (bp): 4969
• Vector type: Bacterial Expression

Growth in Bacteria

• Bacterial Resistance(s): Ampicillin, 100 μg/mL
• Growth Temperature: 37°C
• Growth Strain(s): DH5alpha
• Copy number: High Copy

Gene/Insert

• Gene/Insert name: PTBP1 isoform 4
• Alt name: hnRNP1
• Species: H. sapiens (human)
• Insert Size (bp): 1680
• Mutation: isoform 4 (isoform a)
• Entrez Gene: PTBP1 (a.k.a. HNRNP-I, HNRNPI, HNRPI, PTB, PTB-1, PTB-T, PTB2, PTB3, PTB4, pPTB)
• Promoter: tac
• Tag / Fusion Protein:
  • GST (N terminal on backbone)

Cloning Information

• Cloning method: Restriction Enzyme
• 5′ cloning site: EcoRI (unknown if destroyed)
• 3′ cloning site: XhoI (unknown if destroyed)
• 5′ sequencing primer: GGGCTGGCAAGCCACGTTTGGTG
• 3′ sequencing primer: CCGGGAGCTGCATGTGTCAGAGG

Terms and Licenses

• Academic/Nonprofit Terms:
  • UBMTA
• Industry Terms:
  • Not Available to Industry

Depositor Comments

For expression of recombinant protein use E.coli BL21. GST tag can be cleaved with Thrombin