GST PTBP1 isoform 4
(Plasmid
#108594)
-
PurposeRecombinant GST tagged protein production
-
Depositing Lab
-
Sequence Information
Ordering
Item | Catalog # | Description | Quantity | Price (USD) | |
---|---|---|---|---|---|
Plasmid | 108594 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $85 |
Backbone
-
Vector backbonepGEX4T1
-
Backbone manufacturerGE Healthcare Life Sciences
- Backbone size w/o insert (bp) 4969
-
Vector typeBacterial Expression
Growth in Bacteria
-
Bacterial Resistance(s)Ampicillin, 100 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)DH5alpha
-
Copy numberHigh Copy
Gene/Insert
-
Gene/Insert namePTBP1 isoform 4
-
Alt namehnRNP1
-
SpeciesH. sapiens (human)
-
Insert Size (bp)1680
-
Mutationisoform 4 (isoform a)
-
Entrez GenePTBP1 (a.k.a. HNRNP-I, HNRNPI, HNRPI, PTB, PTB-1, PTB-T, PTB2, PTB3, PTB4, pPTB)
- Promoter tac
-
Tag
/ Fusion Protein
- GST (N terminal on backbone)
Cloning Information
- Cloning method Restriction Enzyme
- 5′ cloning site EcoRI (unknown if destroyed)
- 3′ cloning site XhoI (unknown if destroyed)
- 5′ sequencing primer GGGCTGGCAAGCCACGTTTGGTG
- 3′ sequencing primer CCGGGAGCTGCATGTGTCAGAGG (Common Sequencing Primers)
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
Depositor Comments
For expression of recombinant protein use E.coli BL21. GST tag can be cleaved with Thrombin
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
GST PTBP1 isoform 4 was a gift from Chris Smith (Addgene plasmid # 108594 ; http://n2t.net/addgene:108594 ; RRID:Addgene_108594) -
For your References section:
Nuclear matrix protein Matrin3 regulates alternative splicing and forms overlapping regulatory networks with PTB. Coelho MB, Attig J, Bellora N, Konig J, Hallegger M, Kayikci M, Eyras E, Ule J, Smith CW. EMBO J. 2015 Mar 4;34(5):653-68. doi: 10.15252/embj.201489852. Epub 2015 Jan 19. 10.15252/embj.201489852 PubMed 25599992