pEJS578_DD-dSpyCas9-mCherry-APEX2
(Plasmid #108570)

• Purpose: Expression of drug-inducible dSpyCas9-mCherry-APEX2 for biotin-labeling genomic element-associated protein factors
• Depositing Lab: Erik Sontheimer
• Publication: Gao et al Nat Methods. 2018 Jun;15(6):433-436. doi: 10.1038/s41592-018-0006-2. Epub 2018 May 7.

Backbone

• Vector backbone: pHAGE-DEST
• Backbone size w/o insert (bp): 6000
• Total vector size (bp): 12774
• Vector type: Mammalian Expression, Lentiviral, CRISPR

Growth in Bacteria

• Bacterial Resistance(s): Ampicillin, 100 μg/mL
• Growth Temperature: 37°C
• Growth Strain(s): NEB Stable
• Copy number: High Copy

Gene/Insert

• Gene/Insert name: dSpyCas9
• Species: Synthetic
• Insert Size (bp): 4113
• Promoter: CMV
• Tags / Fusion Proteins:
  • Destabilization domains (N terminal on insert)
  • mCherry (C terminal on insert)
  • Flag (C terminal on insert)
  • APEX2 (C terminal on insert)

Cloning Information

• Cloning method: Restriction Enzyme
• 5′ cloning site: MluI (not destroyed)
• 3′ cloning site: SpeI (not destroyed)
• 5′ sequencing primer: cgcaaatgggcggtaggcgtg

Resource Information

• Supplemental Documents:
  • pEJS578 (DD_dSpyCas9_mCherry_APEX2).gbk
• A portion of this plasmid was derived from a plasmid made by: pHAGE-TO-DD-dCas9-mCherry was a gift from David Grunwald lab (published in Ma et al J. Cell Biol. 2016).
• Articles Citing this Plasmid:
  • 2 References

Terms and Licenses

• Academic/Nonprofit Terms:
  • UBMTA
  • Takara Bio Limited Use Label License (formerly Clontech)
• Industry Terms:
  • Not Available to Industry

Depositor Comments

CRISPR-Cas9 nuclear dynamics and target recognition in living cells. Ma, H., Tu, L.-C., Naseri, A., Huisman, M., Zhang, S., Grunwald, D., and Pederson, T. (2016). CRISPR-Cas9 nuclear dynamics and target recognition in living cells. The Journal of Cell Biology 214, 529–537.