-
PurposeBacterial sgRNA expression vector
-
Depositing Lab
-
Sequence Information
Ordering
Item | Catalog # | Description | Quantity | Price (USD) | |
---|---|---|---|---|---|
Plasmid | 108552 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $85 |
Backbone
-
Vector backbonepTAKN2
- Backbone size w/o insert (bp) 2739
- Total vector size (bp) 2876
-
Vector typeBacterial Expression
Growth in Bacteria
-
Bacterial Resistance(s)Kanamycin, 50 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)DH5alpha
-
Copy numberHigh Copy
Gene/Insert
-
Gene/Insert name2x Streptococcus pyogenes sgRNA
-
gRNA/shRNA sequenceaGAGACCcgggatGGTCTCa and aGAAGAGCcggcGCTCTTCa
- Promoter J23119
Cloning Information
- Cloning method Gibson Cloning
- 5′ sequencing primer M13F
- 3′ sequencing primer GGCGGAGCCTATGGAAAAAC (Common Sequencing Primers)
Resource Information
-
Supplemental Documents
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
pTAKN2_J23119-sgRNA was a gift from Akihiko Kondo (Addgene plasmid # 108552 ; http://n2t.net/addgene:108552 ; RRID:Addgene_108552) -
For your References section:
Deaminase-mediated multiplex genome editing in Escherichia coli. Banno S, Nishida K, Arazoe T, Mitsunobu H, Kondo A. Nat Microbiol. 2018 Feb 5. pii: 10.1038/s41564-017-0102-6. doi: 10.1038/s41564-017-0102-6. 10.1038/s41564-017-0102-6 [pii] PubMed 29403014