pScI_dCas9-CDA_J23119-sgRNA
(Plasmid #108550)

• Purpose: Bacterial Target-AID vector with sgRNA
• Depositing Lab: Akihiko Kondo
• Publication: Banno et al Nat Microbiol. 2018 Feb 5. pii: 10.1038/s41564-017-0102-6. doi: 10.1038/s41564-017-0102-6.

Backbone

• Vector backbone: pSC101
• Backbone size w/o insert (bp): 9263
• Total vector size (bp): 10639
• Vector type: Bacterial Expression

Growth in Bacteria

• Bacterial Resistance(s): Chloramphenicol, 12.5 μg/mL
• Growth Temperature: 30°C
• Growth Strain(s): Top10
• Growth instructions: Allow cells to recover for 2 hr in SOC medium. Transformed cells grow slow and colony formation takes 2 days. Do not pick larger colonies as escape cells may appear.
• Copy number: Low Copy

Gene/Insert 1

• Gene/Insert name: dCas9-PmCDA1
• Species: Synthetic; Streptococcus pyogenes
• Insert Size (bp): 7252
• Mutation: D10A and H840A for SpCas9
• GenBank ID: OYN72315.1 ABO15149.1
• Promoter: lambda OR
• Tag / Fusion Protein:
  • Flag

Cloning Information for Gene/Insert 1

• Cloning method: Gibson Cloning
• 5′ sequencing primer: taaatctatcaccgcaaggg
• 3′ sequencing primer: M13F

Gene/Insert 2

• Gene/Insert name: Streptococcus pyogenes sgRNA
• Species: Synthetic
• Insert Size (bp): 138
• Promoter: J23119

Cloning Information for Gene/Insert 2

• Cloning method: Gibson Cloning
• 5′ sequencing primer: ggccctgcaaccattatc
• 3′ sequencing primer: gcgtggatccggcttac

Resource Information

• Supplemental Documents:
  • pScI_dCas9-CDA_J23119-sgRNA(301).gb

Terms and Licenses

• Academic/Nonprofit Terms:
  • UBMTA
• Industry Terms:
  • Not Available to Industry