Skip to main content
Addgene

pLX304-PCDH7-c
(Plasmid #108540)

Print

Ordering

This material is available to academics and nonprofits only.
Item Catalog # Description Quantity Price (USD)
Plasmid 108540 Standard format: Plasmid sent in bacteria as agar stab 1 $85
Add to Cart

Backbone

  • Vector backbone
    pLX304
  • Backbone manufacturer
    David Root Lab, addgene #25890
  • Backbone size w/o insert (bp) 9377
  • Total vector size (bp) 11497
  • Vector type
    Mammalian Expression, Lentiviral
  • Selectable markers
    Blasticidin

Growth in Bacteria

  • Bacterial Resistance(s)
    Ampicillin, 100 μg/mL
  • Growth Temperature
    30°C
  • Growth Strain(s)
    NEB Stable
  • Copy number
    High Copy

Gene/Insert

  • Gene/Insert name
    PCDH7 transcript variant c
  • Species
    H. sapiens (human)
  • Insert Size (bp)
    3748
  • GenBank ID
    NM_032457.3
  • Entrez Gene
    PCDH7 (a.k.a. BH-Pcdh, BHPCDH, PPP1R120)
  • Promoter CMV

Cloning Information

  • Cloning method Gateway Cloning
  • 5′ sequencing primer cgcaaatgggcggtaggcgtg
  • 3′ sequencing primer ACCGAGGAGAGGGTTAGGGAT
    • (Common Sequencing Primers)

Resource Information

Terms and Licenses

  • Academic/Nonprofit Terms
  • Industry Terms
    • Not Available to Industry
Trademarks:
  • Zeocin® is an InvivoGen trademark.

Depositor Comments

Full-length cDNA of PCDH7 transcript variant c, including the stop codon, was cloned into pLX304 vector (Addgene, #25890) to generate this construct. Therefore, although pLX304 has a downstream V5 tag coding sequence, the PCDH7 transcript variant c is NOT expressed as V5-tagged protein.

How to cite this plasmid ( Back to top)

These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.

  • For your Materials & Methods section:

    pLX304-PCDH7-c was a gift from Kathryn O’Donnell (Addgene plasmid # 108540 ; http://n2t.net/addgene:108540 ; RRID:Addgene_108540)

  • For your References section:

    PROTOCADHERIN 7 Acts through SET and PP2A to Potentiate MAPK Signaling by EGFR and KRAS during Lung Tumorigenesis. Zhou X, Updegraff BL, Guo Y, Peyton M, Girard L, Larsen JE, Xie XJ, Zhou Y, Hwang TH, Xie Y, Rodriguez-Canales J, Villalobos P, Behrens C, Wistuba II, Minna JD, O'Donnell KA. Cancer Res. 2017 Jan 1;77(1):187-197. doi: 10.1158/0008-5472.CAN-16-1267-T. Epub 2016 Nov 7. 10.1158/0008-5472.CAN-16-1267-T PubMed 27821484
Related items:
Commonly requested with: