CBh-dCas9-Mll3SET
(Plasmid #108452)

• Purpose: Expression vector of CRISPR/dCas9 fused with SET domain of mouse MLL3 gene, driven by CBh promoter
• Depositing Lab: Bing Ren
• Publication: Yan et al Cell Res. 2018 Jan 9. pii: cr20181. doi: 10.1038/cr.2018.1.

Backbone

• Vector backbone: pCMV7
• Vector type: Mammalian Expression

Growth in Bacteria

• Bacterial Resistance(s): Ampicillin, 100 μg/mL
• Growth Temperature: 37°C
• Growth Strain(s): DH5alpha
• Copy number: High Copy

Gene/Insert

• Gene/Insert name: dCas9, MLL3
• Species: M. musculus (mouse)
• GenBank ID: NM_001081383
• Entrez Gene: Kmt2c (a.k.a. E330008K23Rik, HALR, Mll3)
• Promoter: CBh

Cloning Information

• Cloning method: Restriction Enzyme
• 5′ cloning site: SpeI (not destroyed)
• 3′ cloning site: ClaI (not destroyed)
• 5′ sequencing primer: CGTTACATAACTTACGGTAA
• 3′ sequencing primer: ATCATGATCCTTGTAGTCT

Resource Information

• Supplemental Documents:
  • 3xFLAG-dCas9_CBh_SET.gb
• A portion of this plasmid was derived from a plasmid made by: Genescript Synthesis

Terms and Licenses

• Academic/Nonprofit Terms:
  • UBMTA
• Industry Terms:
  • Not Available to Industry