Skip to main content
Addgene

CBh-dCas9-Mll3SET
(Plasmid #108452)

Print

Ordering

This material is available to academics and nonprofits only.
Item Catalog # Description Quantity Price (USD)
Plasmid 108452 Standard format: Plasmid sent in bacteria as agar stab 1 $85
Add to Cart

Backbone

  • Vector backbone
    pCMV7
  • Vector type
    Mammalian Expression

Growth in Bacteria

  • Bacterial Resistance(s)
    Ampicillin, 100 μg/mL
  • Growth Temperature
    37°C
  • Growth Strain(s)
    DH5alpha
  • Copy number
    High Copy

Gene/Insert

  • Gene/Insert name
    dCas9, MLL3
  • Species
    M. musculus (mouse)
  • GenBank ID
    NM_001081383
  • Entrez Gene
    Kmt2c (a.k.a. E330008K23Rik, HALR, Mll3)
  • Promoter CBh

Cloning Information

  • Cloning method Restriction Enzyme
  • 5′ cloning site SpeI (not destroyed)
  • 3′ cloning site ClaI (not destroyed)
  • 5′ sequencing primer CGTTACATAACTTACGGTAA
  • 3′ sequencing primer ATCATGATCCTTGTAGTCT
    • (Common Sequencing Primers)

Resource Information

  • Supplemental Documents
  • A portion of this plasmid was derived from a plasmid made by
    Genescript Synthesis

Terms and Licenses

  • Academic/Nonprofit Terms
  • Industry Terms
    • Not Available to Industry
Trademarks:
  • Zeocin® is an InvivoGen trademark.
How to cite this plasmid ( Back to top)

These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.

  • For your Materials & Methods section:

    CBh-dCas9-Mll3SET was a gift from Bing Ren (Addgene plasmid # 108452 ; http://n2t.net/addgene:108452 ; RRID:Addgene_108452)

  • For your References section:

    Histone H3 lysine 4 monomethylation modulates long-range chromatin interactions at enhancers. Yan J, Chen SA, Local A, Liu T, Qiu Y, Dorighi KM, Preissl S, Rivera CM, Wang C, Ye Z, Ge K, Hu M, Wysocka J, Ren B. Cell Res. 2018 Jan 9. pii: cr20181. doi: 10.1038/cr.2018.1. 10.1038/cr.2018.1 PubMed 29313530
Related items:
Commonly requested with: