Skip to main content
This website uses cookies to ensure you get the best experience. By continuing to use this site, you agree to the use of cookies.

Please note: Your browser does not support the features used on Addgene's website. You may not be able to create an account or request plasmids through this website until you upgrade your browser. Learn more

Please note: Your browser does not fully support some of the features used on Addgene's website. If you run into any problems registering, depositing, or ordering please contact us at [email protected]. Learn more

Addgene

pcDNA5/FRT/TO-TPI_WT-xrRNA-4H
(Plasmid #108377)

Ordering

Item Catalog # Description Quantity Price (USD)
Plasmid 108377 Standard format: Plasmid sent in bacteria as agar stab 1 $85

This material is available to academics and nonprofits only.

Backbone

  • Vector backbone
    pcDNA5/FRT/TO
  • Backbone manufacturer
    Thermo Fisher Scientific
  • Vector type
    Mammalian Expression
  • Selectable markers
    Hygromycin

Growth in Bacteria

  • Bacterial Resistance(s)
    Ampicillin, 100 μg/mL
  • Growth Temperature
    37°C
  • Growth Strain(s)
    DH5alpha
  • Copy number
    High Copy

Gene/Insert

  • Gene/Insert name
    Wild type TPI reporter with MVE xrRNA and 4H probe binding sites
  • Species
    H. sapiens (human)
  • Entrez Gene
    TPI1 (a.k.a. HEL-S-49, TIM, TPI, TPID)
  • Promoter CMV

Cloning Information

  • Cloning method Restriction Enzyme
  • 5′ cloning site NheI (unknown if destroyed)
  • 3′ cloning site NotI (unknown if destroyed)
  • 5′ sequencing primer CGCAAATGGGCGGTAGGCGTG
  • 3′ sequencing primer TAGAAGGCACAGTCGAGG
  • (Common Sequencing Primers)

Resource Information

Terms and Licenses

  • Academic/Nonprofit Terms
  • Industry Terms
    • Not Available to Industry
Trademarks:
  • Zeocin® is an InvivoGen trademark.

Depositor Comments

Please see depositor's genbank file in Supplemental Documents for full annotation of the plasmid

How to cite this plasmid ( Back to top)

These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.

  • For your Materials & Methods section:

    pcDNA5/FRT/TO-TPI_WT-xrRNA-4H was a gift from Niels Gehring (Addgene plasmid # 108377 ; http://n2t.net/addgene:108377 ; RRID:Addgene_108377)
  • For your References section:

    Interrogating the degradation pathways of unstable mRNAs with XRN1-resistant sequences. Boehm V, Gerbracht JV, Marx MC, Gehring NH. Nat Commun. 2016 Dec 5;7:13691. doi: 10.1038/ncomms13691. 10.1038/ncomms13691 PubMed 27917860