pCI-TPI_WT-TNFalpha_3UTR-xrRNA-4H
(Plasmid #108374)

• Purpose: Expresses wild type TPI reporter; contains partial TNFalpha 3' UTR; enables detection of 5'-3' decay intermediates (xrFrag) and allows detection via northern blot (4H binding sites)
• Depositing Lab: Niels Gehring
• Publication: Boehm et al Nat Commun. 2016 Dec 5;7:13691. doi: 10.1038/ncomms13691.

Backbone

• Vector backbone: pCI-neo
• Backbone manufacturer: Promega
• Vector type: Mammalian Expression
• Selectable markers: Neomycin (select with G418)

Growth in Bacteria

• Bacterial Resistance(s): Ampicillin, 100 μg/mL
• Growth Temperature: 37°C
• Growth Strain(s): DH5alpha
• Copy number: High Copy

Gene/Insert

• Gene/Insert name: Wild type TPI reporter with partial TNFalpha control 3' UTR, MVE xrRNA and 4H probe binding sites
• Species: H. sapiens (human)
• Entrez Gene: TPI1 (a.k.a. HEL-S-49, TIM, TPI, TPID)
• Entrez Gene: TNF (a.k.a. DIF, TNF-alpha, TNFA, TNFSF2, TNLG1F)
• Promoter: CMV

Cloning Information

• Cloning method: Restriction Enzyme
• 5′ cloning site: NheI (unknown if destroyed)
• 3′ cloning site: NotI (unknown if destroyed)
• 5′ sequencing primer: GGTGTCCACTCCCAGTTCA
• 3′ sequencing primer: TGCATTCTAGTTGTGGTTTGTC

Resource Information

• Supplemental Documents:
  • pCI-TPI_WT-TNFalpha_3UTR-xrRNA-4H.gbk
• Article Citing this Plasmid:
  • 1 Reference

Terms and Licenses

• Academic/Nonprofit Terms:
  • UBMTA
• Industry Terms:
  • Not Available to Industry

Depositor Comments

Please see depositor's genbank file in Supplemental Documents for full annotation of the plasmid