Skip to main content
Addgene

pBV163
(Plasmid #108364)

Print

Ordering

This material is available to academics and nonprofits only.
Item Catalog # Description Quantity Price (USD)
Plasmid 108364 Standard format: Plasmid sent in bacteria as agar stab 1 $85
Add to Cart

Backbone

  • Vector backbone
    pFA6a
  • Backbone size w/o insert (bp) 2648
  • Total vector size (bp) 10207
  • Vector type
    Replace C.glabrata YAP1 promoter with C. glabrata TDH3 promoter
  • Selectable markers
    Nourseothricin

Growth in Bacteria

  • Bacterial Resistance(s)
    Ampicillin, 100 μg/mL
  • Growth Temperature
    37°C
  • Growth Strain(s)
    DH5alpha
  • Copy number
    High Copy

Gene/Insert

  • Gene/Insert name
    Knock-in Cg TDH3 promoter in Cg YAP1 gene
  • Species
    S. cerevisiae (budding yeast), Synthetic; Candida glabrata
  • Promoter TDH3

Cloning Information

  • Cloning method Gibson Cloning
  • 5′ sequencing primer GGGTTTTCCCAGTCACGACGTTG
  • 3′ sequencing primer AAACAGCTATGACCATGATTA
    • (Common Sequencing Primers)

Resource Information

Terms and Licenses

  • Academic/Nonprofit Terms
  • Industry Terms
    • Not Available to Industry
Trademarks:
  • Zeocin® is an InvivoGen trademark.
How to cite this plasmid ( Back to top)

These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.

  • For your Materials & Methods section:

    pBV163 was a gift from Scott Moye-Rowley (Addgene plasmid # 108364 ; http://n2t.net/addgene:108364 ; RRID:Addgene_108364)

  • For your References section:

    Construction and Use of a Recyclable Marker To Examine the Role of Major Facilitator Superfamily Protein Members in Candida glabrata Drug Resistance Phenotypes. Vu BG, Moye-Rowley WS. mSphere. 2018 Mar 28;3(2). pii: mSphere00099-18. doi: 10.1128/mSphere.00099-18. eCollection 2018 Mar-Apr. 10.1128/mSphere.00099-18 PubMed 29600281
Related items: