Skip to main content
This website uses cookies to ensure you get the best experience. By continuing to use this site, you agree to the use of cookies.

Please note: Your browser does not support the features used on Addgene's website. You may not be able to create an account or request plasmids through this website until you upgrade your browser. Learn more

Please note: Your browser does not fully support some of the features used on Addgene's website. If you run into any problems registering, depositing, or ordering please contact us at [email protected]. Learn more

Addgene

pBV65
(Plasmid #108363)

Ordering

This material is available to academics and nonprofits only.
Item Catalog # Description Quantity Price (USD)
Plasmid 108363 Standard format: Plasmid sent in bacteria as agar stab 1 $85

Backbone

  • Vector backbone
    pFA6a
  • Backbone size w/o insert (bp) 2468
  • Total vector size (bp) 8096
  • Modifications to backbone
    loxP sites flank insert
  • Vector type
    Gene disruption marker for Candida glabrata
  • Selectable markers
    Nourseothricin

Growth in Bacteria

  • Bacterial Resistance(s)
    Ampicillin, 100 μg/mL
  • Growth Temperature
    37°C
  • Growth Strain(s)
    DH5alpha
  • Copy number
    High Copy

Gene/Insert

  • Gene/Insert name
    loxP-natMX6-CgMET3prom-cre-loxP
  • Alt name
    Recyclable nat cassette
  • Species
    Candida glabrata
  • Promoter C. glabrata MET3

Cloning Information

  • Cloning method Gibson Cloning
  • 5′ sequencing primer gtacgctgcaggtcgacaac
  • 3′ sequencing primer gccactagtggatctgatatcacc
  • (Common Sequencing Primers)

Resource Information

Terms and Licenses

  • Academic/Nonprofit Terms
  • Industry Terms
    • Not Available to Industry
Trademarks:
  • Zeocin® is an InvivoGen trademark.
How to cite this plasmid ( Back to top)

These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.

  • For your Materials & Methods section:

    pBV65 was a gift from Scott Moye-Rowley (Addgene plasmid # 108363 ; http://n2t.net/addgene:108363 ; RRID:Addgene_108363)
  • For your References section:

    Construction and Use of a Recyclable Marker To Examine the Role of Major Facilitator Superfamily Protein Members in Candida glabrata Drug Resistance Phenotypes. Vu BG, Moye-Rowley WS. mSphere. 2018 Mar 28;3(2). pii: mSphere00099-18. doi: 10.1128/mSphere.00099-18. eCollection 2018 Mar-Apr. 10.1128/mSphere.00099-18 PubMed 29600281