Ath-HEN1::T2A::mCherry::TY1::H2B-pCFJ350-ttTi5605
(Plasmid
#108362)
-
PurposeExpression of 2xFlag MYC tagged A.thaliana-HEN1 (Ath-HEN1, codon optimised for C. elegans) and mCherry under the promoter of choice in C. elegans
-
Depositing Lab
-
Sequence Information
Ordering
Item | Catalog # | Description | Quantity | Price (USD) | |
---|---|---|---|---|---|
Plasmid | 108362 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $85 |
Backbone
-
Vector backbonepCFJ350-ttTi5605
- Backbone size w/o insert (bp) 7517
- Total vector size (bp) 12670
-
Modifications to backboneThe cassette for bicistronic expression of Ath-HEN1 and mCherry-H2B was inserted into pCFJ350-ttTi5605 by Gibson cloning between the M13 FWD and M13 REV priming sites.
-
Vector typeWorm Expression
Growth in Bacteria
-
Bacterial Resistance(s)Ampicillin, 100 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)DH5alpha
-
Copy numberHigh Copy
Gene/Insert 1
-
Gene/Insert nameAth-HEN1
-
Alt nameA. thaliana HEN1
-
SpeciesA. thaliana (mustard weed); Codon optimised for C. elegans
-
Insert Size (bp)2979
-
Entrez GeneHEN1 (a.k.a. AT4G20910, CORYMBOSA 2, CRM2, HUA ENHANCER 1, T13K14.70, T13K14_70)
- Promoter Ath-HEN1 coding sequence
-
Tags
/ Fusion Proteins
- 2xFlag (N terminal on insert)
- MYC (N terminal on insert)
Cloning Information for Gene/Insert 1
- Cloning method Gibson Cloning
- 5′ sequencing primer CCGGCCggcgcgccGCTAGCcaccatggattacaaggatgacg
- 3′ sequencing primer GAGGTCGGTCTTCTTCTTCTCAAC (Common Sequencing Primers)
Gene/Insert 2
-
Gene/Insert namemCherry
-
Insert Size (bp)708
- Promoter mCherry
-
Tag
/ Fusion Protein
- T2A peptide (N terminal on insert)
Cloning Information for Gene/Insert 2
- Cloning method Gibson Cloning
- 5′ sequencing primer AGAAGAAGAAGACCGACCTCgagggcagaggaagtctgc
- 3′ sequencing primer TCCTGATTGGTATGCACTTCcttgtacagctcgtccatgcc (Common Sequencing Primers)
Gene/Insert 3
-
Gene/Insert namehis-15
-
Alt namehistone sequence
-
SpeciesC. elegans (nematode)
-
Insert Size (bp)369
-
Entrez Genehis-15 (a.k.a. CELE_ZK131.9)
- Promoter H2B
-
Tag
/ Fusion Protein
- TY1 linker (N terminal on insert)
Cloning Information for Gene/Insert 3
- Cloning method Gibson Cloning
- 5′ sequencing primer GAAGTGCATACCAATCAGGACCC
- 3′ sequencing primer CTCAGATATCAATACCATGCCTATTACTTGCTGGAAGTGTACTTGG (Common Sequencing Primers)
Gene/Insert 4
-
Gene/Insert nameunc-54 3' UTR
-
SpeciesC. elegans (nematode)
-
Insert Size (bp)733
- Promoter A rab-3:Ath-HEN1:unc-54 3' UTR was cloned as a unique AvrII fragment from an intermediate vector into pCFJ350-ttTi5605
Cloning Information for Gene/Insert 4
- Cloning method Restriction Enzyme
- 5′ cloning site AvrII (not destroyed)
- 3′ cloning site AvrII (not destroyed)
- 5′ sequencing primer TTTTCCTAGGGATTACGCCAAGCTTGCATGC
- 3′ sequencing primer AAAACCTAGGCACCGTCATCACCGAAACGC (Common Sequencing Primers)
Resource Information
-
Supplemental Documents
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
Ath-HEN1::T2A::mCherry::TY1::H2B-pCFJ350-ttTi5605 was a gift from Luisa Cochella (Addgene plasmid # 108362 ; http://n2t.net/addgene:108362 ; RRID:Addgene_108362) -
For your References section:
Cell-type specific sequencing of microRNAs from complex animal tissues. Alberti C, Manzenreither RA, Sowemimo I, Burkard TR, Wang J, Mahofsky K, Ameres SL, Cochella L. Nat Methods. 2018 Feb 26. pii: nmeth.4610. doi: 10.1038/nmeth.4610. 10.1038/nmeth.4610 PubMed 29481550