Str-KDEL_SBP-mCherry-WNT3A
(Plasmid #108345)

• Purpose: synchronize trafficking of WNT3A from the ER (RUSH System)
• Depositing Lab: David Virshup
• Publication: Moti et al PLoS One. 2019 Feb 22;14(2):e0212711. doi: 10.1371/journal.pone.0212711. eCollection 2019.

Backbone

• Vector backbone: pIRESneo3
• Backbone manufacturer: Clontech
• Total vector size (bp): 6953
• Vector type: Mammalian Expression
• Selectable markers: mCherry

Growth in Bacteria

• Bacterial Resistance(s): Ampicillin, 100 μg/mL
• Growth Temperature: 37°C
• Growth Strain(s): DH5alpha
• Copy number: High Copy

Gene/Insert

• Gene/Insert name: WNT3A, Wnt family member 3A
• Species: H. sapiens (human)
• Insert Size (bp): 1002
• Entrez Gene: WNT3A
• Promoter: CMV
• Tags / Fusion Proteins:
  • mCherry (N terminal on insert)
  • IL-2 Signal Sequence and Streptavidin Binding Protein (SBP) (N terminal on insert)

Cloning Information

• Cloning method: Unknown
• 5′ sequencing primer: CGCAAATGGGCGGTAGGCGTG

Resource Information

• Supplemental Documents:
  • 108345-SBP-mCherry-Wnt3A_update.gbk

Terms and Licenses

• Academic/Nonprofit Terms:
  • UBMTA
  • Takara Bio Limited Use Label License (formerly Clontech)
• Industry Terms:
  • Not Available to Industry