p28atDarpp
(Plasmid #108318)

• Purpose: Expresses tDarpp in E.coli
• Depositing Lab: Jamil Momand
• Publication: Momand et al FEBS Open Bio. 2017 Aug 29;7(9):1328-1337. doi: 10.1002/2211-5463.12269. eCollection 2017 Sep.

Backbone

• Vector backbone: pET28a
• Backbone manufacturer: Novagen
• Backbone size w/o insert (bp): 5369
• Total vector size (bp): 5760
• Vector type: Bacterial Expression

Growth in Bacteria

• Bacterial Resistance(s): Kanamycin, 50 μg/mL
• Growth Temperature: 37°C
• Growth Strain(s): BL21(DE3)
• Growth instructions: Use BL21(DE3) for protein expression
• Copy number: Unknown

Gene/Insert

• Gene/Insert name: tDarpp
• Alt name: truncated DARPP-32 isoform t-DARPP (PPP1R1B)
• Species: H. sapiens (human)
• Insert Size (bp): 525
• GenBank ID: AY070271.1
• Entrez Gene: PPP1R1B (a.k.a. DARPP-32, DARPP32)
• Promoter: T7
• Tag / Fusion Protein:
  • 6 Histadine (C terminal on insert)

Cloning Information

• Cloning method: Restriction Enzyme
• 5′ cloning site: NcoI (unknown if destroyed)
• 3′ cloning site: XhoI (unknown if destroyed)
• 5′ sequencing primer: gatccgccatggtgttccggctctcagagcactcc
• 3′ sequencing primer: cttagactcgagtgtgccaggctcagagggggaag

Resource Information

• A portion of this plasmid was derived from a plasmid made by: Dr. Susan Kane, City of Hope

Terms and Licenses

• Academic/Nonprofit Terms:
  • UBMTA
• Industry Terms:
  • Not Available to Industry

Depositor Comments

L2V substitution was introduced during cloning and is not of functional concern.