Skip to main content
This website uses cookies to ensure you get the best experience. By continuing to use this site, you agree to the use of cookies.

Please note: Your browser does not support the features used on Addgene's website. You may not be able to create an account or request plasmids through this website until you upgrade your browser. Learn more

Please note: Your browser does not fully support some of the features used on Addgene's website. If you run into any problems registering, depositing, or ordering please contact us at [email protected]. Learn more

Addgene

p005-RFP-strong
(Plasmid #108317)

Ordering

This material is available to academics and nonprofits only.
Item Catalog # Description Quantity Price (USD)
Plasmid 108317 Standard format: Plasmid sent in bacteria as agar stab 1 $85

Backbone

  • Vector backbone
    pJ401
  • Backbone manufacturer
    DNA2.0
  • Backbone size w/o insert (bp) 3654
  • Total vector size (bp) 4466
  • Vector type
    Bacterial Expression

Growth in Bacteria

  • Bacterial Resistance(s)
    Kanamycin, 50 μg/mL
  • Growth Temperature
    37°C
  • Growth Strain(s)
    DH5alpha
  • Copy number
    High Copy

Gene/Insert

  • Gene/Insert name
    RFP under controlf of strong synthetic constitutive promoter pFAB4005
  • Species
    Synthetic; Corynactis
  • Insert Size (bp)
    813
  • Promoter pFAB4005

Cloning Information

  • Cloning method Gibson Cloning
  • 5′ sequencing primer CTCGAAAATAATAAAGGGAAAATCAG
  • 3′ sequencing primer CTCAGAAGTGAAACGCCGTA
  • (Common Sequencing Primers)

Resource Information

  • Supplemental Documents
  • A portion of this plasmid was derived from a plasmid made by
    It was synthesized by DNA2.0

Terms and Licenses

Trademarks:
  • Zeocin® is an InvivoGen trademark.

Depositor Comments

How to cite this plasmid ( Back to top)

These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.

  • For your Materials & Methods section:

    p005-RFP-strong was a gift from Jaroslaw Bryk (Addgene plasmid # 108317 ; http://n2t.net/addgene:108317 ; RRID:Addgene_108317)
  • For your References section:

    UNIGEMS: plasmids and parts to facilitate teaching on assembly, gene expression control and logic in E. coli. Siddall A, Williams AA, Sanders J, Denton JA, Madden D, Schollar J, Bryk J. bioRxiv 2021.06.20.449138 10.1101/2021.06.20.449138