-
PurposeGFP from jellyfish Aquorea sp. under pBAD promoter with AraC repressor; kanamycin resistant.
-
Depositing Lab
-
Publication
-
Sequence Information
Ordering
Item | Catalog # | Description | Quantity | Price (USD) | |
---|---|---|---|---|---|
Plasmid | 108315 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $85 |
Backbone
-
Vector backbonepJ401
-
Backbone manufacturerDNA2.0
- Backbone size w/o insert (bp) 3541
- Total vector size (bp) 4646
-
Vector typeBacterial Expression
Growth in Bacteria
-
Bacterial Resistance(s)Kanamycin, 50 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)DH5alpha
-
Copy numberHigh Copy
Gene/Insert
-
Gene/Insert nameGFP under control of arabinose-inducible promoter pBAD
-
SpeciesA. victoria
- Promoter pBAD
Cloning Information
- Cloning method Gibson Cloning
- 5′ sequencing primer CTCGAAAATAATAAAGGGAAAATCAGT
- 3′ sequencing primer CTCAGAAGTGAAACGCCGTA (Common Sequencing Primers)
Resource Information
-
Supplemental Documents
-
A portion of this plasmid was derived from a plasmid made bySynthesized by LifeTechnologies and/or IDT DNA
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
Depositor Comments
Please visit https://www.biorxiv.org/content/10.1101/2021.06.20.449138v1 for bioRxiv preprint.
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
p006-GFP-pBAD was a gift from Jaroslaw Bryk (Addgene plasmid # 108315 ; http://n2t.net/addgene:108315 ; RRID:Addgene_108315) -
For your References section:
UNIGEMS: plasmids and parts to facilitate teaching on assembly, gene expression control and logic in E. coli. Siddall A, Williams AA, Sanders J, Denton JA, Madden D, Schollar J, Bryk J. bioRxiv 2021.06.20.449138 10.1101/2021.06.20.449138