pET28a-MH6-RspCas13d_RspCasWYL1
(Plasmid #108304)

• Purpose: Expresses E. coli codon optimized RspCas13d and RspCasWYL1 in the pET28a backbone.
• Depositing Lab: Arbor Biotechnologies
• Publication: Yan et al Mol Cell. 2018 Mar 9. pii: S1097-2765(18)30173-4. doi: 10.1016/j.molcel.2018.02.028.

Backbone

• Vector backbone: pET-28a(+)
• Backbone manufacturer: Novagen
• Backbone size w/o insert (bp): 5390
• Total vector size (bp): 9420
• Vector type: Bacterial Expression, CRISPR

Growth in Bacteria

• Bacterial Resistance(s): Kanamycin, 50 μg/mL
• Growth Temperature: 37°C
• Growth Strain(s): DH5alpha
• Copy number: Low Copy

Gene/Insert 1

• Gene/Insert name: RspCas13d
• Species: Synthetic
• Insert Size (bp): 2763
• Promoter: lac
• Tag / Fusion Protein:
  • mH6 tag (N terminal on insert)

Cloning Information for Gene/Insert 1

• Cloning method: Restriction Enzyme
• 5′ cloning site: EcoRI (not destroyed)
• 3′ cloning site: EcoRI (not destroyed)
• 5′ sequencing primer: ATGGCCAAAAAGAACAAAATGAAACC

Gene/Insert 2

• Gene/Insert name: RspWYL1
• Species: Synthetic
• Insert Size (bp): 1182
• Tag / Fusion Protein:
  • mH6 tag (N terminal on insert)

Cloning Information for Gene/Insert 2

• Cloning method: Restriction Enzyme
• 5′ cloning site: BamHI (not destroyed)
• 3′ cloning site: BamHI (not destroyed)
• 5′ sequencing primer: ATGCTGATTCCGCCTAGCAC

Resource Information

• Article Citing this Plasmid:
  • 1 Reference

Terms and Licenses

• Academic/Nonprofit Terms:
  • UBMTA
• Industry Terms:
  • Not Available to Industry

Depositor Comments

For commercial use, please contact Arbor Biotechnologies at .