-
PurposeExpresses E. coli codon optimized EsCas13d in the pET28a backbone.
-
Depositing Lab
-
Sequence Information
Ordering
Item | Catalog # | Description | Quantity | Price (USD) | |
---|---|---|---|---|---|
Plasmid | 108303 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $85 |
Backbone
-
Vector backbonepET-28a(+)
-
Backbone manufacturerNovagen
- Backbone size w/o insert (bp) 5390
- Total vector size (bp) 8252
-
Vector typeBacterial Expression, CRISPR
Growth in Bacteria
-
Bacterial Resistance(s)Kanamycin, 50 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)DH5alpha
-
Copy numberLow Copy
Gene/Insert
-
Gene/Insert nameEsCas13d
-
SpeciesSynthetic
-
Insert Size (bp)2862
- Promoter lac
-
Tag
/ Fusion Protein
- mH6 tag (N terminal on insert)
Cloning Information
- Cloning method Restriction Enzyme
- 5′ cloning site EcoRI (not destroyed)
- 3′ cloning site EcoRI (not destroyed)
- 5′ sequencing primer atgggcaaaaaaatccatgcac (Common Sequencing Primers)
Resource Information
-
Supplemental Documents
-
Articles Citing this Plasmid
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
Depositor Comments
For commercial use, please contact Arbor Biotechnologies at [email protected].
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
pET28a-MH6-EsCas13d was a gift from Arbor Biotechnologies (Addgene plasmid # 108303 ; http://n2t.net/addgene:108303 ; RRID:Addgene_108303) -
For your References section:
Cas13d Is a Compact RNA-Targeting Type VI CRISPR Effector Positively Modulated by a WYL-Domain-Containing Accessory Protein. Yan WX, Chong S, Zhang H, Makarova KS, Koonin EV, Cheng DR, Scott DA. Mol Cell. 2018 Mar 9. pii: S1097-2765(18)30173-4. doi: 10.1016/j.molcel.2018.02.028. 10.1016/j.molcel.2018.02.028 PubMed 29551514