Skip to main content
This website uses cookies to ensure you get the best experience. By continuing to use this site, you agree to the use of cookies.

Please note: Your browser does not support the features used on Addgene's website. You may not be able to create an account or request plasmids through this website until you upgrade your browser. Learn more

Please note: Your browser does not fully support some of the features used on Addgene's website. If you run into any problems registering, depositing, or ordering please contact us at [email protected]. Learn more

Addgene

pGEX2T-TEV CHMP1B 186-199
(Plasmid #108285)

Ordering

This material is available to academics and nonprofits only.
Item Catalog # Description Quantity Price (USD)
Plasmid 108285 Standard format: Plasmid sent in bacteria as agar stab 1 $85

Backbone

  • Vector backbone
    pGEX2T-TEV
  • Backbone manufacturer
    Amersham
  • Backbone size w/o insert (bp) 4993
  • Total vector size (bp) 5029
  • Modifications to backbone
    TEV cleavage site added
  • Vector type
    Bacterial Expression

Growth in Bacteria

  • Bacterial Resistance(s)
    Ampicillin, 100 μg/mL
  • Growth Temperature
    37°C
  • Growth Strain(s)
    DH5alpha
  • Copy number
    Low Copy

Gene/Insert

  • Gene/Insert name
    CHMP1B
  • Alt name
    C18orf2
  • Species
    H. sapiens (human)
  • Insert Size (bp)
    48
  • Mutation
    amino acids 186-199
  • Entrez Gene
    CHMP1B (a.k.a. C10orf2, C18-ORF2, C18orf2, CHMP1.5, Vps46-2, Vps46B, hVps46-2)
  • Tag / Fusion Protein
    • GST (N terminal on backbone)

Cloning Information

  • Cloning method Restriction Enzyme
  • 5′ cloning site NdeI (not destroyed)
  • 3′ cloning site BamHI (not destroyed)
  • 5′ sequencing primer GGGCTGGCAAGCCACGTTTGGTG
  • 3′ sequencing primer CCGGGAGCTGCATGTGTCAGAGG
  • (Common Sequencing Primers)

Resource Information

Terms and Licenses

  • Academic/Nonprofit Terms
  • Industry Terms
    • Not Available to Industry
Trademarks:
  • Zeocin® is an InvivoGen trademark.
How to cite this plasmid ( Back to top)

These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.

  • For your Materials & Methods section:

    pGEX2T-TEV CHMP1B 186-199 was a gift from Wesley Sundquist (Addgene plasmid # 108285 ; http://n2t.net/addgene:108285 ; RRID:Addgene_108285)
  • For your References section:

    Membrane constriction and thinning by sequential ESCRT-III polymerization. Nguyen HC, Talledge N, McCullough J, Sharma A, Moss FR 3rd, Iwasa JH, Vershinin MD, Sundquist WI, Frost A. Nat Struct Mol Biol. 2020 Apr;27(4):392-399. doi: 10.1038/s41594-020-0404-x. Epub 2020 Apr 6. 10.1038/s41594-020-0404-x PubMed 32251413