Skip to main content
Addgene

pLV(shRNA)-Puro-6 CCEPR Vb2
(Plasmid #108278)

Ordering

This material is available to academics and nonprofits only.
Item Catalog # Description Quantity Price (USD)
Plasmid 108278 Standard format: Plasmid sent in bacteria as agar stab 1 $85

Backbone

  • Vector backbone
    pLV-puro-U6
  • Backbone size w/o insert (bp) 7520
  • Total vector size (bp) 7567
  • Vector type
    Lentiviral
  • Selectable markers
    Puromycin

Growth in Bacteria

  • Bacterial Resistance(s)
    Ampicillin, 100 μg/mL
  • Growth Temperature
    37°C
  • Growth Strain(s)
    NEB Stable
  • Copy number
    High Copy

Gene/Insert

  • Gene/Insert name
    CCEPR
  • gRNA/shRNA sequence
    CCEPR
  • Species
    H. sapiens (human)
  • Entrez Gene
    CCEPR (a.k.a. CCHE1, lncRNA-CCHE1)
  • Promoter U6

Cloning Information

  • Cloning method Unknown
  • 5′ sequencing primer GAGGGCCTATTTCCCATGATTC
  • 3′ sequencing primer CAAGGGTAGCGGCGAAGATC
  • (Common Sequencing Primers)

Resource Information

  • Supplemental Documents
  • A portion of this plasmid was derived from a plasmid made by
    This vector was purchased from VectorBuilder.

Terms and Licenses

  • Academic/Nonprofit Terms
  • Industry Terms
    • Not Available to Industry
Trademarks:
  • Zeocin® is an InvivoGen trademark.
How to cite this plasmid ( Back to top)

These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.

  • For your Materials & Methods section:

    pLV(shRNA)-Puro-6 CCEPR Vb2 was a gift from Karl Munger (Addgene plasmid # 108278 ; http://n2t.net/addgene:108278 ; RRID:Addgene_108278)
  • For your References section:

    Expression of the cervical carcinoma expressed PCNA regulatory (CCEPR) long noncoding RNA is driven by the human papillomavirus E6 protein and modulates cell proliferation independent of PCNA. Sharma S, Munger K. Virology. 2018 Feb 7;518:8-13. doi: 10.1016/j.virol.2018.01.031. 10.1016/j.virol.2018.01.031 PubMed 29427865