pLV(shRNA)-Puro-U6-CCEPR
(Plasmid
#108277)
-
PurposeshRNA for CCEPR lncRNA
-
Depositing Lab
-
Sequence Information
Ordering
Item | Catalog # | Description | Quantity | Price (USD) | |
---|---|---|---|---|---|
Plasmid | 108277 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $85 |
Backbone
-
Vector backbonepLV-puro-U6
- Backbone size w/o insert (bp) 7520
- Total vector size (bp) 7567
-
Vector typeLentiviral
-
Selectable markersPuromycin
Growth in Bacteria
-
Bacterial Resistance(s)Ampicillin, 100 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)NEB Stable
-
Copy numberHigh Copy
Gene/Insert
-
Gene/Insert nameCCEPR
-
gRNA/shRNA sequenceCCEPR
-
SpeciesH. sapiens (human)
-
Entrez GeneCCEPR (a.k.a. CCHE1, lncRNA-CCHE1)
- Promoter U6
Cloning Information
- Cloning method Unknown
- 5′ sequencing primer GAGGGCCTATTTCCCATGATTC
- 3′ sequencing primer CAAGGGTAGCGGCGAAGATC (Common Sequencing Primers)
Resource Information
-
Supplemental Documents
-
A portion of this plasmid was derived from a plasmid made byThis vector was purchased from VectorBuilder.
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
pLV(shRNA)-Puro-U6-CCEPR was a gift from Karl Munger (Addgene plasmid # 108277 ; http://n2t.net/addgene:108277 ; RRID:Addgene_108277) -
For your References section:
Expression of the cervical carcinoma expressed PCNA regulatory (CCEPR) long noncoding RNA is driven by the human papillomavirus E6 protein and modulates cell proliferation independent of PCNA. Sharma S, Munger K. Virology. 2018 Feb 7;518:8-13. doi: 10.1016/j.virol.2018.01.031. 10.1016/j.virol.2018.01.031 PubMed 29427865