-
Depositing Lab
-
Publication
-
Sequence Information
Ordering
Item | Catalog # | Description | Quantity | Price (USD) | |
---|---|---|---|---|---|
Plasmid | 10825 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $85 |
Backbone
-
Vector backbonepIRESneo
-
Backbone manufacturerClontech
- Backbone size w/o insert (bp) 5328
-
Vector typeMammalian Expression
-
Selectable markersNeomycin (select with G418)
Growth in Bacteria
-
Bacterial Resistance(s)Ampicillin, 100 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)DH5alpha
-
Copy numberHigh Copy
Gene/Insert
-
Gene/Insert nameEYFP
-
SpeciesAequorea victoria
-
Insert Size (bp)726
-
Tags
/ Fusion Proteins
- FLAG (N terminal on insert)
- HA (N terminal on insert)
Cloning Information
- Cloning method Restriction Enzyme
- 5′ cloning site BamHI (not destroyed)
- 3′ cloning site EcoRI (not destroyed)
- 5′ sequencing primer ggtaccgagctcggatcgat
- 3′ sequencing primer agctgttggggtgagtactcc (Common Sequencing Primers)
Resource Information
-
Articles Citing this Plasmid
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
Depositor Comments
Note that this plasmid was previously identified as pIRESneo-FLAG/HA EGFP from Meister et al., but the insert has been identified as EYFP, not EGFP. Addgene has changed the name and information for this plasmid based on this discovery.
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
pIRESneo-FLAG/HA EYFP was a gift from Thomas Tuschl (Addgene plasmid # 10825 ; http://n2t.net/addgene:10825 ; RRID:Addgene_10825) -
For your References section:
Human Argonaute2 mediates RNA cleavage targeted by miRNAs and siRNAs. Meister G, Landthaler M, Patkaniowska A, Dorsett Y, Teng G, Tuschl T. Mol Cell. 2004 Jul 23. 15(2):185-97. 10.1016/j.molcel.2004.07.007 PubMed 15260970