Skip to main content
Addgene

pIreSneo-FLAG/HA Ago3
(Plasmid #10823)

Print

Ordering

This material is available to academics and nonprofits only.
Item Catalog # Description Quantity Price (USD)
Plasmid 10823 Standard format: Plasmid sent in bacteria as agar stab 1 $85
Add to Cart

Backbone

  • Vector backbone
    pIRESneo
  • Backbone manufacturer
    Clontech
  • Backbone size w/o insert (bp) 5310
  • Vector type
    Mammalian Expression
  • Selectable markers
    Neomycin (select with G418)

Growth in Bacteria

  • Bacterial Resistance(s)
    Ampicillin, 100 μg/mL
  • Growth Temperature
    37°C
  • Growth Strain(s)
    DH5alpha
  • Copy number
    High Copy

Gene/Insert

  • Gene/Insert name
    Argonaute 3
  • Species
    H. sapiens (human)
  • Insert Size (bp)
    2583
  • Mutation
    1 silent mutation
  • GenBank ID
    NM_024852
  • Entrez Gene
    AGO3 (a.k.a. EIF2C3)
  • Tags / Fusion Proteins
    • FLAG (N terminal on insert)
    • HA (N terminal on insert)

Cloning Information

  • Cloning method Restriction Enzyme
  • 5′ cloning site NotI (not destroyed)
  • 3′ cloning site EcoRI (not destroyed)
  • 5′ sequencing primer ggtaccgagctcggatcgat
  • 3′ sequencing primer agctgttggggtgagtactcc
    • (Common Sequencing Primers)

Resource Information

Terms and Licenses

  • Academic/Nonprofit Terms
  • Industry Terms
    • Not Available to Industry
Trademarks:
  • Zeocin® is an InvivoGen trademark.

Depositor Comments

A small insertion in the 5'UTR should not affect the expressed peptide.

How to cite this plasmid ( Back to top)

These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.

  • For your Materials & Methods section:

    pIreSneo-FLAG/HA Ago3 was a gift from Thomas Tuschl (Addgene plasmid # 10823 ; http://n2t.net/addgene:10823 ; RRID:Addgene_10823)

  • For your References section:

    Human Argonaute2 mediates RNA cleavage targeted by miRNAs and siRNAs. Meister G, Landthaler M, Patkaniowska A, Dorsett Y, Teng G, Tuschl T. Mol Cell. 2004 Jul 23. 15(2):185-97. 10.1016/j.molcel.2004.07.007 PubMed 15260970
Related items:
Commonly requested with: