pIRESneo-FLAG/HA Ago2 corrected
(Plasmid #10822)

• Depositing Lab: Thomas Tuschl
• Publication: Meister et al Mol Cell. 2004 Jul 23. 15(2):185-97.

Backbone

• Vector backbone: pIRESneo
• Backbone size w/o insert (bp): 5310
• Vector type: Mammalian Expression
• Selectable markers: Neomycin (select with G418)

Growth in Bacteria

• Bacterial Resistance(s): Ampicillin, 100 μg/mL
• Growth Temperature: 37°C
• Growth Strain(s): DH5alpha
• Copy number: High Copy

Gene/Insert

• Gene/Insert name: Argonaute 2
• Species: H. sapiens (human)
• Insert Size (bp): 2580
• Mutation: 3 silent mutations in orf
• GenBank ID: NM_012154
• Entrez Gene: AGO2 (a.k.a. CASC7, EIF2C2, LESKRES, LINC00980, PPD, Q10)
• Tags / Fusion Proteins:
  • FLAG (N terminal on insert)
  • HA (N terminal on insert)

Cloning Information

• Cloning method: Restriction Enzyme
• 5′ cloning site: NotI (not destroyed)
• 3′ cloning site: EcoRI (not destroyed)
• 5′ sequencing primer: ggtaccgagctcggatcgat
• 3′ sequencing primer: agctgttggggtgagtactcc

Resource Information

• Articles Citing this Plasmid:
  • 51 References

Terms and Licenses

• Academic/Nonprofit Terms:
  • UBMTA
• Industry Terms:
  • Not Available to Industry