UBQ10:sXVE:S10-(MCS)
(Plasmid
#108177)
-
Purpose(Empty Backbone) Binary vectors used for the inducible expression of tripartite split-sfGFP components in plants
-
Depositing Lab
-
Publication
-
Sequence Information
Ordering
Item | Catalog # | Description | Quantity | Price (USD) | |
---|---|---|---|---|---|
Plasmid | 108177 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $85 |
Backbone
-
Vector backboneUBQ10:sXVE:GFPc:Kan
-
Backbone manufacturerJörg Kudla
- Backbone size (bp) 14452
-
Vector typePlant Expression, Synthetic Biology
- Promoter UBQ10:sXVE:
-
Selectable markersKanamycin
Growth in Bacteria
-
Bacterial Resistance(s)Kanamycin, 50 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)DH5alpha
-
Copy numberLow Copy
Cloning Information
- Cloning method Restriction Enzyme
- 5′ sequencing primer cttcgcaagacccttcc
- 3′ sequencing primer TCGCGTATTAAATGTATAATTGCGGGACTC (Common Sequencing Primers)
Resource Information
-
Article Citing this Plasmid
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
UBQ10:sXVE:S10-(MCS) was a gift from Tzu-Yin Liu (Addgene plasmid # 108177 ; http://n2t.net/addgene:108177 ; RRID:Addgene_108177) -
For your References section:
Detection of membrane protein-protein interaction in planta based on dual intein-coupled tripartite split-GFP association. Liu TY, Chou WC, Chen WY, Chu CY, Dai CY, Wu PY. Plant J. 2018 Feb 16. doi: 10.1111/tpj.13874. 10.1111/tpj.13874 PubMed 29451720