Skip to main content
This website uses cookies to ensure you get the best experience. By continuing to use this site, you agree to the use of cookies.

Please note: Your browser does not support the features used on Addgene's website. You may not be able to create an account or request plasmids through this website until you upgrade your browser. Learn more

Please note: Your browser does not fully support some of the features used on Addgene's website. If you run into any problems registering, depositing, or ordering please contact us at [email protected]. Learn more

Addgene

pF CAG BFP2 IRES neo
(Plasmid #108175)

Ordering

This material is available to academics and nonprofits only.
Item Catalog # Description Quantity Price (USD)
Plasmid 108175 Standard format: Plasmid sent in bacteria as agar stab 1 $85

Backbone

  • Vector backbone
    pF CAG luc IRES neo (Addgene plasmid # 98294)
  • Backbone manufacturer
    Brett Stringer
  • Total vector size (bp) 11809
  • Modifications to backbone
    The firefly luciferase gene of pF CAG luc IRES neo was removed by BamHI/NheI digestion and BamHI/NheI-digested BFP2, PCR-amplified from pBAD-mTagBFP2 (Addgene plasmid # 34632), was cloned in its place.
  • Vector type
    Mammalian Expression, Lentiviral ; Fluorescent protein
  • Selectable markers
    Neomycin (select with G418)

Growth in Bacteria

  • Bacterial Resistance(s)
    Ampicillin, 100 μg/mL
  • Growth Temperature
    30°C
  • Growth Strain(s)
    NEB Stable
  • Growth instructions
    Single colonies of transformed STBL3 or STBL4 cells cultured in 5 ml of LB broth containing 100 micrograms/ml ampicillin for 20 hours at 37oC, 200 rpm give good yields for plasmid minipreps.
  • Copy number
    High Copy

Gene/Insert

  • Gene/Insert name
    Blue fluorescent protein (BFP2)
  • Alt name
    BFP2
  • Species
    Synthetic
  • Insert Size (bp)
    711
  • Promoter CAG

Cloning Information

  • Cloning method Restriction Enzyme
  • 5′ cloning site BamHI (not destroyed)
  • 3′ cloning site NheI (not destroyed)
  • 5′ sequencing primer GTCCCCTTCTCCATCTCCAG
  • 3′ sequencing primer ACGCACACCGGCCTTATTC
  • (Common Sequencing Primers)

Resource Information

  • A portion of this plasmid was derived from a plasmid made by
    Addgene plasmid34632

Terms and Licenses

Trademarks:
  • Zeocin® is an InvivoGen trademark.
How to cite this plasmid ( Back to top)

These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.

  • For your Materials & Methods section:

    pF CAG BFP2 IRES neo was a gift from Brett Stringer (Addgene plasmid # 108175 ; http://n2t.net/addgene:108175 ; RRID:Addgene_108175)
  • For your References section:

    A reference collection of patient-derived cell line and xenograft models of proneural, classical and mesenchymal glioblastoma. Stringer BW, Day BW, D'Souza RCJ, Jamieson PR, Ensbey KS, Bruce ZC, Lim YC, Goasdoue K, Offenhauser C, Akgul S, Allan S, Robertson T, Lucas P, Tollesson G, Campbell S, Winter C, Do H, Dobrovic A, Inglis PL, Jeffree RL, Johns TG, Boyd AW. Sci Rep. 2019 Mar 20;9(1):4902. doi: 10.1038/s41598-019-41277-z. 10.1038/s41598-019-41277-z PubMed 30894629