pSirenRetroQ(puro)-shEgr4
(Plasmid
#108117)
-
PurposepSIREN-RetroQ vector containing shRNA sequence to Egr4
-
Depositing Lab
-
Sequence Information
Ordering
Item | Catalog # | Description | Quantity | Price (USD) | |
---|---|---|---|---|---|
Plasmid | 108117 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $85 |
Backbone
-
Vector backbonepSirenRetroQ(puro)
-
Backbone manufacturerClontech
- Backbone size w/o insert (bp) 6445
- Total vector size (bp) 6508
-
Vector typeMammalian Expression, Retroviral, RNAi
-
Selectable markersPuromycin
Growth in Bacteria
-
Bacterial Resistance(s)Ampicillin, 100 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)NEB Stable
-
Copy numberHigh Copy
Gene/Insert
-
Gene/Insert nameshRNA to Egr4
-
Alt nameEarly growth response 4
-
gRNA/shRNA sequenceAAGTCTTTGGATGTGATGTTT
-
SpeciesM. musculus (mouse)
-
Entrez GeneEgr4 (a.k.a. NGF1-C, NGFI-C, NGFIC, pAT133)
- Promoter U6
Cloning Information
- Cloning method Restriction Enzyme
- 5′ cloning site BamHI (not destroyed)
- 3′ cloning site EcoRI (not destroyed)
- 5′ sequencing primer U6 fwd (Common Sequencing Primers)
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
Depositor Comments
For the chosen sequence (AAGTCTTTGGATGTGATGTTT), the annealed oligos are:
5'-gatccAAGTCTTTGGATGTGATGTTTTTCAAGAGAAAACATCACATCCAAAGACTTTTTTTTACGCGTg-----3'
3'-----gTTCAGAAACCTACACTACAAAAAGTTCTCTTTTGTAGTGTAGGTTTCTGAAAAAAAATGCGCActtaa-5'
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
pSirenRetroQ(puro)-shEgr4 was a gift from Peter Johnson (Addgene plasmid # 108117 ; http://n2t.net/addgene:108117 ; RRID:Addgene_108117) -
For your References section:
An Arf-Egr-C/EBPbeta pathway linked to ras-induced senescence and cancer. Salotti J, Sakchaisri K, Tourtellotte WG, Johnson PF. Mol Cell Biol. 2015 Mar;35(5):866-83. doi: 10.1128/MCB.01489-14. Epub 2014 Dec 22. 10.1128/MCB.01489-14 PubMed 25535333