pCFJ150-Cas9(dpiRNA)
(Plasmid
#107940)
-
Purposeeft-3p::Cas9(dpiRNA)::tbb-2 3'UTR construct used for MosSCI in nematode. Cas9 is optimized by removing all piRNA targeting sites to allow germline expression.
-
Depositing Lab
-
Sequence Information
Ordering
Item | Catalog # | Description | Quantity | Price (USD) | |
---|---|---|---|---|---|
Plasmid | 107940 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $85 |
Backbone
-
Vector backbonepCFJ150
- Total vector size (bp) 12682
-
Vector typeWorm Expression
Growth in Bacteria
-
Bacterial Resistance(s)Ampicillin, 100 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)DH5alpha
-
Copy numberUnknown
Gene/Insert
-
Gene/Insert nameCas9(dpiRNA)
-
SpeciesC. elegans (nematode)
-
Insert Size (bp)4277
- Promoter eft-3
Cloning Information
- Cloning method Gibson Cloning
- 5′ sequencing primer TGTTTTTTTTTCAGTTGGGAAACACCC
- 3′ sequencing primer gagaagaagggaatgcttgaaagg (Common Sequencing Primers)
Resource Information
-
Supplemental Documents
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
pCFJ150-Cas9(dpiRNA) was a gift from Heng-Chi Lee (Addgene plasmid # 107940 ; http://n2t.net/addgene:107940 ; RRID:Addgene_107940) -
For your References section:
The piRNA targeting rules and the resistance to piRNA silencing in endogenous genes. Zhang D, Tu S, Stubna M, Wu WS, Huang WC, Weng Z, Lee HC. Science. 2018 Feb 2;359(6375):587-592. doi: 10.1126/science.aao2840. Epub 2018 Feb 1. 10.1126/science.aao2840 PubMed 29420292